Красный пузыреплодник: Пузыреплодник Ред Барон (Red Baron)

Содержание

посадка и уход, сорта, размножение

Среди множества декоративных кустарников пузыреплодник Ред Барон занимает особое место. Никого не оставляет равнодушным раскидистый куст с ярко-красными, блестящими листьями, покрывающийся в начале лета большими бело-розовыми цветами. Сорт имеет высоту до 2-х. метров, и сохраняет окраску листьев в течении всего теплого периода.

Уход за пузыреплодником

Уход за растением не требует специальной подготовки. Хорошо растет на почвах разного состава, не теряет яркости листа в городских условиях. Переносит загрязненный автомобильными выбросами воздух.

Городские выхлопные газы растению не страшны

На открытых, солнечных участках листья пузыреплодника ярко-красные, образуют густую, плотную крону.

В полутени цвет сохраняется. В тенистых местах листья Ред Барона приобретают бурый оттенок в верхней части и зеленый внизу.

Несмотря на неприхотливость растения, нужно соблюдать необходимые условия, позволяющие пузыреплоднику хорошо расти.

Полив Обязательный полив, в жаркое время 2-3 раза в неделю
Рыхление Регулярно рыхлить почву около стволов. Соблюдать осторожность, чтобы не повредить корни
Обрезка Два раза в год проводить обрезку
Подкормка Весной и осенью осуществлять подкормку
Обработка почвы Весной проводить санитарную обработку почвы вокруг растения

Высадка в открытом грунте

Высаживают саженцы в открытый грунт весной или осенью (апрель, октябрь). Если саженец имеет закрытые корни, т.е. сажается с комом земли на корнях, посадить его можно и летом. Подготовка ямы для саженца не занимает много времени.

  • Выкапываете яму достаточной глубины.
  • Выложить слой питательной почвы на дно.
  • Установить саженец и присыпать землей, смешанной с питательной почвой.
  • Питательная почва содержит в себе смесь равных долей: песок, торф, дерн, земля.
Как и с другими цветами, оптимальная почва – это сочетание нескольких компонентов

Ветки ствола должны быть закопаны в землю не более чем на 1-2 см. После усадки земли через пару дней, добавить землю сверху до ровной поверхности. Не окучивать.

При посадке молодого саженца удобрений не добавлять. Растение будет проходить естественную адаптацию и не сможет усвоить дополнительный прикорм.

После посадки пузыреплодник обильно полить. Через три-четыре дня произвести первое рыхление почвы.

Прикорневую зону обложить торфом для сохранения влаги.

В почве, на которую высаживают куст, не должно быть извести.

Пузыреплодник хорошо укореняется на любой почве, если отсутствует известь. На суглинистой, рыхлой почве он дает более яркий, пышный цвет как листьев, так и цветов. На скудной, песчаной почве, при своевременной подкормке его качества не теряются.

Регулярно поливать растение, но не чаще, чем 2 раза в неделю и хорошо дренировать.

Возможные болезни

Пузыреплодник Ред Барон очень устойчив к болезням и вредителям. Но для хорошего роста растению будет полезна гигиеническая обработка почвы весной бактериальными и противогрибковыми препаратами, такими как: Гамаир, Алирин, Фитоспорин.

Весной, при полном прогреве земли, необходимо добавить эти препараты в воду для полива. Дозировку рассчитывать по показаниям производителя. Одного полива будет достаточно на весь вегетативный сезон.

При большой скудости почвы у пузыреплодника может развиться пороз. Его проявления заметны сразу, молодые листья и побеги приобретают неестественный ржавый цвет и сохнут.

Устранить причину помогает препарат Филат железа и Фиролитам

. Пороз у растения возникает из-за недостатка в почве железа. Поливка в корень железосодержащих препаратов быстро восстанавливает здоровье.

Для того чтобы снять химический стресс, полученный в результате обработки и поднять иммунитет растения используют антистрессовые препараты, такие как Экогель или Алирин.

Подкормка куста

Удобрять растение следует два раза в году. Использовать прикорм следующего состава:

Весной:

  • 500 мл. коровяка.
  • 25 мл. аммиачной селитры.
  • 25 мл. мочевины.
  • 10 л. воды.

Осенью:

  • 500 мл. коровяка.
  • 25 мл. мочевины.
  • 25 мл. аммиачной селитры.
  • 50 мл. нитрата фосфора.
  • 10 л. воды.

Состав хорошо перемешать, расчет полива такой же как и весной.

Селитра аммиачная
Мочевина
Коровяк

Размножение пузырепложника

Размножение Ред Барона можно произвести вегетативно (), делением куста и семенем.

Отводкой

Это самый простой и эффективный способ размножить растение.

Как это сделать:

  1. Весной, после появления первых листьев выбрать на взрослом кусте молодую и сильную ветку.
  2. Удалить с нее нижние листья.
  3. На нужном расстоянии подготовить яму глубиной до 15 см.
  4. Уложить ветку в яму, осторожно ее согнув, пришпилить деревянными или железными скобами.
  5. Засыпать яму землей или смесью земли с торфом.
  6. Обильно полить.
  7. До осени контролировать своевременный полив и рыхление почвы.
  8. В октябре отделить отводку от куста, пересадить на выбранное место и укрыть на зиму.
Ред Барон дает выбор из нескольких способов размножения

Черенками

  1. Перед выбросом цвета срезать молодые побеги длиной до 20 см., с обязательными двумя-тремя почечными междоузлиями.
  2. Удалить с нижней части черенка все листья, оставшиеся укоротить наполовину.
  3. Замочить в растворе Корневина на 2-3 дня, до появления первых признаков будущего корня.
  4. Высадить в питательную почву. Почва для высадки черенков такого же состава, как и при посадке в грунт.
  5. Укрыть саженцы пленкой. Регулярно поливать и проветривать. К осени черенок сформирует нужную корневую систему.
  6. На зиму черенок укрыть. Пересадить на новое место весной.

Деление куста

Самый быстрый способ размножения и одновременно трудоемкий, т.к. взрослый куст может иметь достаточно развитую корневую систему.

Производить деление куста быстро, чтобы у растения не подсыхали корни:

  1. Оголить полностью корень с той стороны, откуда планируете отрезать половину.
  2. Отделить нужную часть куста, отрубив корень лопатой или любым другим острым инструментом.
  3. Высадить растение в подготовленную яму. Засыпать питательной смесью.
  4. Полить раствором Корневина.
  5. Оставшийся куст подпитать Корневином.

Размножать пузыреплодник семенами в домашних условиях очень сложно и нецелесообразно. Поскольку Ред Барон находится в культуре не так давно, то через размножение семенем он теряет ряд декоративных качеств.

Обрезка

Ред Барон очень быстро растет и нуждается в обрезке. Если Вы хотите сохранить естественный, раскидистый рост веток потребуется санитарная обрезка весной.

Санитарная

Весной, до прогрева почвы срезают обломанные, мерзлые ветки, а так же побеги, растущие внутрь. Осенью, когда куст сбросил листву, его осматривают, обрезают лишние и сухие ветки.

Места срезов крупных побегов можно обработать садовым варом

.

Формирующая

С пузыреплодника можно сформировать любую форму, круглую, квадратную, в форме фонтана.

Если садовод хочет получить куст с обильной листвой, которая благодаря своей красоте и цвету заменит цветы, обрезать следует ветки второго-третьего года и оставлять прошлогодние. Их легко отличить.

Годовые побеги весной выглядят почти черными, глянцевыми. Оставлять нужно хорошо перезимовавшие ветки. Они не дадут цветка, но принесут обильную листву.

Для обрезки рекомендуют использовать острые и чистые инструменты

Ветки, возраст которых два и более года, белесые, толще, на них хорошо заметны почки. Кора у взрослых веток может отслаиваться – это особенность вида. Эти ветви обязательно дадут много цветков.

Если предпочтение отдается цветку, то их следует сохранить, удаляя молодые побеги.

Омолаживающая обрезка пузыреплодника производится на 6 году. Куст обрезают на пень в октябре.

Уход зимой

Сорт Ред Барон морозоустойчив, хорошо переносит морозы до 10С. Если зима предполагается очень холодной, то куст лучше укрыть:

  • С наступлением первых холодных ночей куст осторожно стянуть шпагатом.
  • Обложить околоствольный круг торфом или стружкой.
  • Накрыть колпаком из рубероида. Можно использовать любой другой натуральный утеплитель.
  • Молодые экземпляры и саженцы всегда укрывать на зиму.

Ред барон

Сорт пузыреплодника Ред Барон считается самым ценным среди более чем 25 сортов растения. Его цветок достигает в диаметре 25-50 мм.

Ред Барон относится к калинолистному виду, он был привезен в Европу с Северной Америки, где он обычно растет у берегов рек. Ярко красный куст вырастает до 2-х метров. Листья пятилопастные, похожи на листья калины. Ствол бордовый.

Калинолистный пузыреплодник

Цвести пузыреплодник начинает в начале лета, выбрасывая белые с розовым отливом цветы. После цветения, к середине лета формируется плод. Гроздь состоит из 3-5 остроконечных мешочков.

В начале созревания плоды зеленые, постепенно краснеющие. К осени плоды приобретают блестящий красно-бордовый цвет.

Живая изгородь

Куст пузыреплодника образует широкое и плотное естественное ограждение. Благодаря быстрому росту с кустов можно легко сформировать прямоугольную или квадратную форму.

Часто растение высаживают плотным рядом у основания сеточного или проволочного забора. За сезон кусты разрастаются и полностью скрывают ограду.

Пузыреплодник хорошо высаживать в городах для озеленения дворов, улиц, аллей как живая изгородь.

Высаженный у железного забора пузыреплодник нужно всегда утеплять на зиму.

Сорта

Ред Барон часто называют благодарным растением из-за его стойкости к резким перепадам температур. Болезни редко поражают пузыреплодник, а такие вредители как гусеница, тля и жук предпочитают питаться другими растениями.

Выращивать растение в саду просто, уход за ним минимальный. Пузыреплодник, кроме сорта Ред Барон знаменит такими сортами:

Амурский вид

Лютеус Куст до 3-х метров с ярко желтыми листьями, которые с наступлением осени темнеют
Аурео Маргината Сорт имеет зеленые листья с золотым ободом
Нана Сорт-карлик амурского вида, вырастает до 1,5 м. Имеет ярко зеленый лист

Краснолистный или калинолистный вид

Дьяболо. Сорт калинолистного (краснолистного) пузыреплодника до 3-х метров высоты. Листья имеет красные или бордовые. Цветы всех растений белые, белые с розовым отливом или бледно-розовые.

Разнообразие сортов пузыреплодника дает полное право назвать этот куст листоцветущим.

Сорт Лютеус
Сорт Дьяболо

Яркость красок, которые отличают его от других кустарников на самом деле поразительна. Используя растение и для озеленения и для красоты, садоводы получают и наслаждение и экономию средств, т.к. саженцы растения сравнительно недороги.

Пузыреплодник калинолистный Ред Барон (Physocarpus opulifolius Red Baron )


Используя различные сорта пузыреплодников, Вы можете создать у себя великолепные многоуровневые и многоцветные изгороди.

Диаметр кроны взрослого растения (м): 2

Высота взрослого растения (м): 2


Описание

Абсолютно неприхотливое, очень эффектное и быстрорастущее растение. Хорошо переносит городскую загрязненность. Декоративен в течение всего вегетационного периода своими листвой, цветами и плодами. Прекрасно сохраняет свою яркую окраску на солнечных местах, в тенистых – зеленеет. Рекомендован для широкого применения в озеленении города и частных садов. Способен в течение 2–3 лет закрыть проблемные места, создать яркий элемент в сложных контрастных композициях. Живые изгороди из него очень красивые, плотные и лёгкие в уходе. Используя различные сорта пузыреплодников, вы можете создать у себя великолепные многоуровневые и многоцветные изгороди. Результат дальнейшей селекции пузыреплодников, Ред Барон отличается от Диабло менее интенсивной окраской фактурных листьев, меньшими и более компактными размерами и может быть использован в тех композициях, где Диабло либо слишком велик, либо слишком агрессивно тёмен.


Крона Плотный куст с многочисленными прямыми побегами, образующими густую, полушаровидную крону.

Хвоя/Листва Листья 3–5-лопастные (до 7 см), гофрированные по жилкам, вытянутые, уже, чем у Диабло, тёмно-красные, в полной тени – зелёные с лёгким красноватым оттенком, осенью – бронзовые.

Цветение Цветы многочисленные, бледно-розовые, собранные в щитках (до 5см).

Время цветения

июнь,


Плоды Плоды – сборные (вздутые листовки), фиолетово-красные.

Требования Предпочитает солнечные места, выносит полутень и тень, теряя только интенсивность окрашивания. Растёт на всех типах почв, которые в меру увлажнены и имеют хороший дренаж.

Посадка Перед посадкой корни замачивают в воде на 2–5 часов. В посадочную яму глубиной 60 см насыпают горкой питательный грунт. Затем помещают туда куст, расправляют корни и, не заглубляя корневую шейку, засыпают почвой и уплотняют. Обильно проливают почву.
Контейнерные растения можно сажать весь сезон. Посадку растений с голым корнем проводят ранней весной, до распускания листьев, или в сентябре.

Уход

Уход заключается в периодических поливах, подкормках, рыхлении почвы, формирующей обрезке и в обрезке старых побегов. Появляющиеся на солнце зеленые побеги необходимо вырезать полностью.
Не выносит застоя влаги.
Морозостоек, но могут подмерзать молодые побеги.
Удобряют весной – в ведро воды добавляют ½ литра коровяка (либо птичьего помета), 1 л сорнякового настоя или используют другие азотные удобрения. Осенью – в ведре воды настаивают 1 стакан древесной золы или используют другие минеральные удобрения. Приготовленными растворами осуществляют полив кустарника – 15 литров на одно растение.
Устойчив к вредителям.
Устойчив к болезням.


Размножение Размножается черенками, отводками, делением куста, семенами.

сорта и особенности — sdelayzabor.ru

Пузыреплодник калинолистный давно и успешно используется в ландшафтном дизайне. Европейские селекционеры выращивают новые сорта этого кустарника, которые отличаются неприхотливостью и удивительной декоративностью. Среди всего разнообразия праздничным нарядом отличаются разновидности с листвой, окрашенной разными оттенками красного. Некоторые из них получили заслуженную премию английского Королевского общества садоводов, которая присуждается растениям с особенно выраженными декоративными свойствами и неприхотливостью в уходе и размножении.

Любопытные факты

Краснолистные сорта пузыреплодника предпочитают солнечные открытые места. Хорошо растут и развиваются они также в тени, но яркая листва при этом теряет свою индивидуальность. От недостатка солнечного света она становится зеленой и приобретает обыденный внешний вид.

Специалисты рекомендуют размножать пузыреплодник с красной листвой одним из следующих способов: делением куста, черенкованием, отводками. Хорошую всхожесть дают и семена. Но вряд ли саженцы, выращенные таким способом, обретут все сортовые особенности. С большой долей вероятности их листья будут зелеными, а не красными.

Сорта пузыреплодника отличаются не только цветом листьев. Разновидности, имеющие красную листву, во время цветения покрываются россыпью розовых соцветий, что добавляет декоративности кустарникам.

Сорта с красными листьями

Краснолистные кустарники пузыреплодника разнообразны по форме куста и оттенкам листвы. Наибольшую популярность приобрели следующие сорта:

Diabolo (Диаболо)

Пузыреплодник сорт Диаболо

Могущественные кустарники этого сорта пузыреплодника, если пустить их рост на самотек, могут достигать в высоту 3,5 метров, а в ширину – 2 метров. Несмотря на то, что ветви у растения тонкие, не превышающие 1 сантиметра в диаметре, они отличаются высокой плотностью посадки листвы. Множество листиков темно-бордового цвета имеют эллиптическую форму. Глядя на них, кажется, что они устремлены своими заостренными кончиками исключительно в сторону солнца. Нарядная листва осенью меняет свой цвет на желтый, не менее праздничный.

Summer Wine (Саммер вайн)

Пузыреплодник сорт summer wine

Кустарник с раскидистыми ветвями покрывает яркая листва, своим цветом напоминающая красное крепленое вино. Форма куста и цвет листьев создают необыкновенный эффект. Со стороны они напоминают картину винных брызг или праздничного салюта. Ветви растения достаточно крепкие, в диаметре достигают 1,5 – 2 сантиметра. Кора расслаивающаяся, коричневая. Цветет этот сорт пузыреплодника весной, плотно покрываясь бело-розовыми соцветиями. Сорт хорошо переносит сильные морозы, поэтому на территории России его можно выращивать практически во всех регионах.

Red Baron (Ред Барон)


Пузыреплодник ред барон

Этот сорт пузыреплодника имеет красивую полушаровидную форму кроны. Высота и ширина взрослого растения практически одинакова: 2 метра в высоту и столько же в ширину. Во время цветения кусты покрываются бело-розовыми соцветиями. Темно-красные листья, гофрированные по жилкам, имеют вытянутую форму.  Осенью они меняют свой цвет на бронзовый.

Schuch (Шух)


Пузыреплодник шух

Кустарники этого сорта пузыреплодника достигают 2 метров в высоту. Ветви с красно-коричневой корой покрыты темно-красной листвой и устремлены вверх. Осенью цвет листьев остается неизменным.

Ledi in Red (Леди ин Ред)

Пузыреплодник Леди ин ред (Lady in Red)

Название «Дама в красном» говорит само за себя. Этот сорт пузыреплодника вырастили английские селекционеры. Кусты красивой формы не превышают полутора метров в высоту. Нарядная листва ярко-красного цвета к осени становится более темной.

Это, безусловно, неполный список краснолистных сортов пузыреплодника. Но они являются одними из самых популярных среди европейских специалистов по ландшафтному дизайну. Их красоту, неприхотливость, простоту размножения успели оценить и наши садоводы.

Условия произрастания

О неприхотливости пузыреплодника уже знают многие наши садоводы и специалисты по ландшафту. Преимущества этого растения:

  • засухоустойчивость и морозоустойчивость
  • нетребовательность к почвенному составу
  • неприхотливость в уходе
  • высокая степень декоративности
  • возможность размножения разными способами
  • возможность создания садовых форм с помощью стрижки
  • устойчивость к заболеваниям и атакам вредителей

Несмотря на все достоинства пузыреплодника, следует помнить, что краснолистные сорта менее устойчивы к сильным морозам, в отличие от основных растений. Поэтому молодые саженцы в первый год после посадки следует укрывать на время зимних холодов. Весной обязательно потребуется санитарная обрезка, во время которой нужно удалить все обмерзшие, сухие и поврежденные ветви. Формирующую стрижку делают по мере надобности.

В отличие от основных растений, краснолистные сорта пузыреплодника лучше будут расти и развиваться на плодородных почвах. Следует воздержаться от посадки кустов с красными листьями на суглинках, где есть опасность застоя влаги. От переувлажнения растения могут быть повреждены мучнистой росой.

Весной саженцы можно подкармливать азотными удобрениями, а осенью – калийно-фосфатными. В частом поливе пузыреплодник не нуждается.

Использование в ландшафтном дизайне

Нарядные краснолистные кусты пузыреплодника можно использовать в разных композициях. Из них можно сформировать яркую живую изгородь, украсить одиночной посадкой газон или неприглядный участок сада, включить в декоративную композицию для украшения клумбы или цветника.

Праздничный наряд красного пузыреплодника хорошо сочетается со строгой зеленью хвойников. Ветроустойчивость позволяет высаживать кусты даже на крышах.

Украшая гравийные и каменистые дорожки живой изгородью из пузыреплодника, можно рассчитывать, что красотой можно будет любоваться не менее 30 лет.

Пузыреплодник: Описание, Виды, Посадка, Уход

Немногие декоративные кустарники могут похвастаться яркой листвой, красивым цветением и при этом совершенной неприхотливостью. Это описание в полной мере относится к такому растению как пузыреплодник.

Он не доставит владельцам садовых участков особых хлопот, и с его выращиванием смогут справиться даже начинающие садоводы. Культивируют этот кустарник из-за его высоких декоративных качеств.

Он имеет листья ярких расцветок и пышную густую крону, которая придает растению эффектный вид и не утрачивает своей декоративности на протяжении всего периода вегетации.

Биологическое описание

Кусты пузыреплодника разных сортов

Пузыреплодник – декоративный листопадный кустарник, который относится к семейству Розовые. Род Пузыреплодник насчитывает более 10 видов, из которых наибольшее распространение и популярность получил пузыреплодник калинолистный. В высоту кустарник растет от 1 до 3 метров.

Пузыреплодник используется как в одиночных, так и в групповых посадках, а также для создания живых изгородей и озеленения улиц, скверов, парковых зон. Родина этого растения – Восточная Азия и Северная Америка. В США и Канаде он растет в диком виде в смешанных лесах, долинах и по берегам рек.

Описание пузыреплодника:
  • Кора бурого или коричневого цвета. С возрастом она имеет свойство отслаиваться
  • Листья яйцевидной или эллиптической формы, небольшого размера, примерно 4-10 см длиной. Края листьев пильчато-зубчатые. С верхней стороны листовые пластины имеют темный и насыщенный оттенок, а с нижней стороны они окрашены в более светлые тона
  • Цветки белые или розовые, собранные в выпуклые щитковидные соцветия. Зацветает кустарник в июне-июле и цветет в течение двух-трех недель
  • Плоды представляют собой миниатюрные пузыри-листовки, собранные в щитки

Цветет пузыреплодник

Необычная форма плодов и дала растению такое непривычное название – пузыреплодник. На латыни оно звучит как Physocarpus. Это название произошло от двух греческих слов: physo, что означает «пузырь» и carpos, что переводится как «плод».

Пузыреплодник: декоративный и неприхотливый кустарник

В России пузыреплодник впервые появился в конце XVIII века в ботаническом саду Санкт-Петербурга. На протяжении XIX века были завезены из Северной Америки еще несколько видов растения.

ЭТОТ КУСТАРНИК:

  • является неприхотливым, имеет высокую зимостойкость
  • хорошо переносит условия города
  • не слишком требователен к составу почвы
  • начинает цвести и плодоносить в возрасте 4 лет
  • плохо переносит избыточное увлажнение и застой влаги

Пузыреплодник сохраняет декоративность на протяжении всего периода вегетации. При этом кустарник весьма неприхотлив.

Однако есть два требования, которые нужно соблюдать, чтобы этому растению было комфортно на садовом участке:

1Отсутствие извести в грунте. На почвах с повышенным содержанием извести кустарник будет плохо развиваться.

2Наличие дренажа. Пузыреплодник не терпит застоя влаги, и почвы с высоким уровнем грунтовых вод ему не подходят.

Хотя к составу почвы этот кустарник не слишком требователен, на рыхлый, плодородный и удобренный субстрат он будет отзываться хорошим ростом и пышным видом. Растение устойчиво к загрязнению воздуха. По этой причине его можно выращивать рядом с дорогами.

Огромное преимущество пузыреплодника перед другими декоративными кустарниками – это его хорошая зимостойкость. В средней полосе он без проблем зимует, и лишь очень сильные морозы могут повредить кончики его побегов.

Посадка

Пузыреплодник можно выращивать как в тени, так и на освещенных участках. Однако сорта с пурпурными и золотистыми листьями на солнечных участках будут иметь более яркий оттенок листвы. В тени расцветка листьев со временем бледнеет и становится приглушенной.

Вид Калинолистный (Ред Барон)

Поэтому, если вы хотите добиться большего декоративного эффекта от этого растения, для его посадки следует выбрать открытое солнечное место. Для посадки лучше приобрести материал в питомнике, где продают кустарники в специальных контейнерах, готовые к высадке.

Такие саженцы с закрытой корневой системой можно высаживать не только весной, но и в любой другой период во время вегетации.

Сажаем пузыреплодник

Как правильно посадить этот кустарник, чтобы он принялся и быстро пошел в рост:

1Для посадки подготавливают яму, имеющую глубину и диаметр по 0,5 метра. На ее дно следует положить плодородный садовый грунт, торфяной субстрат или перегной.

2Растение вместе с комом земли нужно осторожно достать из контейнера и поместить в подготовленную посадочную яму. При этом важно не повредить корни и стараться их не расправлять.

3Яму с растением следует засыпать почвой, желательно плодородной, а саженец углубить на 5 см. Такой прием поможет кустарнику дать дополнительные новые отростки из спящих почек.

4После посадки кусты пузыреплодника следует полить водой, в которую можно добавить Корневин, а затем необходимо замульчировать приствольный круг.

Молодой кустик сорта Коппертина (Coppertina)

При подобной обработке не будет образовываться поверхностная корка, а корни растения смогут получить достаточное количество воздуха.

Читайте также: Боярышник: описание, его полезные свойства и противопоказания, отвары и настойки (20 рецептов), заготовки на зиму

Размножение

Этот кустарник размножается несколькими способами. У каждого из них есть свои особенности, на которые нужно обратить внимание.

Размножение семенами

Плоды пузыреплодника с семенами

Семена пузыреплодника дают хорошую всхожесть, однако при таком способе размножения нет гарантии сохранения всех сортовых особенностей. Велика вероятность, что у кустов, выращенных из семян, листья будут не красного, а зеленого цвета.

По этой причине размножение семенами применяется крайне редко. Чтобы сохранить оригинальный окрас листьев, размножать пузыреплодник следует вегетативным способом.

Черенкование

Размножение черенками

Это самый простой и достаточно популярный метод, который дает быстрые и традиционно хорошие результаты. Для размножения черенкованием используют зеленые побеги, которые нарезают длиной 10-20 см. Важно, чтобы на каждом черенке было по несколько точек роста.

Черенкование проводят весной или в начале лета, до цветения кустарника:

1Черенки отделяют, с нижней половины побега листья удаляют, а с верхней – наполовину укорачивают. Можно также поцарапать кожицу у основания черенков: считается, что в этих местах корешки образуются быстрее.

2Основания полученных черенков замачивают в любом из стимуляторов корнеобразования. Этот этап не является обязательным, поскольку пузыреплодник может успешно укореняться и без стимуляции.

3Побеги высаживают в речной песок или субстрат, состоящий из песка с торфом.

4После посадки черенки следует полить и укрыть полиэтиленовой пленкой.

5Последующий уход до начала зимы заключается в проветривании и систематическом увлажнении. Когда начнут появляться новые листья и побеги, что свидетельствует об успешном укоренении, пленку можно будет снять.

6На зиму укорененные черенки следует укрыть, лучше всего еловым лапником. Основания стеблей мульчируют листвой, торфом или землей.

7Весной молодую поросль можно будет высадить на постоянное место.

Деление куста

Молодые кусты растения

Этот способ менее популярен, чем черенкование, поскольку требует физических усилий, а число молодых растений, полученных в результате деления куста, очень ограничено. Один хорошо развитый взрослый куст можно разделить на 4-6 частей.

Следует проводить деление куста ранней весной, до наступления периода активного роста.

Возможно поведение этой процедуры осенью, после того, как кустарник отцветет, а до морозов останется минимум полтора месяца:

1Под деленки готовят посадочные ямы, а стебли обрезают на уровне 60-70 см. Это пойдет пузыреплоднику только на пользу и будет дополнительным стимулом для появления новых побегов.

2Растение аккуратно выкапывают, полностью извлекая из грунта корневую систему.

3Куст делят таким образом, чтобы каждой части досталось хорошее корневище и одна мощная здоровая ветка длиной более 20 см.

4Отделенные части нужно высадить на новое место как можно быстрее, чтобы не допустить пересыхания корней.

5После этого растения поливают и мульчируют почву, чтобы избежать образования корки.

6В первый год отделенные молодые растения нуждаются в укрытии на зиму.

Размножение отводками

Это достаточно распространенный способ размножения. Проводят такую процедуру в апреле, после того как на побегах появятся первые листочки, чтобы за период вегетации отводок успел укорениться.

Порядок размножения отводками таков:

1С побега удаляют практически все листья, кроме тех, которые находятся на самой верхушке.

2В земле под веткой делают канавку глубиной до 10-15 см.

3Не отрезая подготовленный побег с куста, укладывают его в канавку, пришпиливают к земле и засыпают плодородным грунтом. Кончик побега необходимо оставить открытым, не засыпая землей.

4Важно поливать почву в чересчур засушливые периоды, поскольку без увлажнения еще не совсем окрепшие корни могут погибнуть.

5В конце осени молодые укоренившиеся кусты отделяют от взрослого растения. На зиму их следует укрыть еловым лапником.

6Такая закладка отводков дает неплохие результаты, если для них выбрать сильные и здоровые побеги, направленные наружу.

Читайте также: Изготовление теплицы своими руками из профильной трубы и поликарбоната: полное описание процесса, чертежи с размерами, полив и обогрев (Фото & Видео)

Уход

Несмотря на свою высокую декоративность, пузыреплодник является очень неприхотливым растением. Он не требует какого-то особого ухода, однако нужно соблюдать некоторые условия: проводить регулярную обрезку, поливать растения и производить подкормки.

При правильном выращивании кусты практически не будут поражаться болезнями и вредителями.

Куст красивой формы

Обрезка

Кустарник может расти до 30-40 лет, и в период вегетации развиваться достаточно быстрыми темпами. При создании благоприятных условий за один год пузыреплодник может дать прирост до 40 см, как высоту, так и в ширину.

В каких случаях растение нуждается в обрезке:
  • для стимуляции активного роста побегов
  • если кроне необходимо придать определенную форму

Процедуру обрезки пузыреплодник переносит безболезненно, и в дальнейшем достаточно быстро обрастает молодыми побегами.

Кроме формирующей обрезки проводят также и санитарную процедуру:
  • санитарная обрезка проводится ранней весной. Ее цель состоит в удалении сломанных, засохших ветвей и подмерзших зимой побегов
  • формирующая обрезка нужна для придания растению требуемой формы. Ее также проводят весной, еще до распускания почек на кустарнике, или осенью, после того как вегетативный период закончится
Существует два типа формирующей обрезки, которые можно применять:
  • если целью обрезки является получение мощного и широкого куста, имеющего большое количество стволов, то ее проводят на уровне 40-50 см
  • для придания растению так называемой «фонтанообразной» формы вырезают все тонкие побеги у основания куста, оставляя до пяти наиболее крепких и сильных ветвей. Эти побеги для стимуляции роста также дополнительно обрезают на высоте 1,5 метра

Полив

Частота полива кустарника зависит от нескольких факторов:

1Вида почвы

2Возраста растения

3Климатической зоны, где оно произрастает

Если почвы в районе выращивания кустарника суглинистые, а летом возможны высокие температуры, то растению необходим регулярный полив (как минимум два раза в неделю). Однако следует избегать перелива и застоя воды.

При переувлажнении куст пузыреплодника рискует подвергнуться заражению мучнистой росой. Это может привести к гибели растения.

Подкормка

Удобряя кустарник можно получить красивую и пынную его форму

Удобрение кустарника проводится дважды за сезон, в весенний и осенний период:

1Ранней весной, при распускании почек, необходимо внести азотосодержащее удобрение.

2Осенью его следует заменить на минеральную подкормку.

Растения хорошо отзываются на удобрение, формируя пышную густую крону.

Зимовка

К достоинствам этого кустарника относится хорошая зимостойкость. В условиях средней полосы пузыреплодник зимует без укрытия. При этом подмерзание верхушек побегов наблюдается лишь в редких случаях и во время очень морозных зим.

В укрытии на зимний период нуждаются только молодые побеги, укорененные в текущем году. Осенью, после обрезки, почву вокруг растений следует замульчировать слоем торфа высотой не менее 8 см. После этого молодые растения необходимо накрыть лапником.

Читайте также: Жимолость: описание 19 популярных сортов, их многообразие и особенности, как отличить ядовитые плоды (35 Фото & Видео) +Отзывы

Виды

Существует более 10 видов этого растения, однако в культуре на территории европейской части страны распространение получили всего два вида:

  • Пузыреплодник амурский (Physocarpus amurensis)
  • Пузыреплодник калинолистный (Physocarpus opulifolius)

Неприхотливые, декоративные и быстрорастущие пузыреплодники – прекрасный материал для живых изгородей. Они хорошо переносят обрезку, при помощи которой кустам можно легко придать желаемую форму.

Пузыреплодник амурский используется в озеленении реже, а самое широкое применение находит в ландшафтном дизайне пузыреплодник калинолистный.

1

Амурский

Пузыреплодник амурский

Родина этого кустарника – смешанные леса Дальнего Востока, Северной Кореи и северной части Китая. Кусты растут в высоту до 3 метров.

Крона имеет широкую шаровидную форму, зеленые листья и цветет небольшими белыми цветками, собранными в щитковидные соцветия.

Плоды представляют собой вздутые листовки, которые краснеют по мере созревания и придают растению привлекательный вид и декоративность осенью. Этот вид зимостоек.

Побеги полностью одревесневают. Растение используется как в одиночных, так и в групповых посадках, а также в качестве живых изгородей.

2

Пузыреплодник калинолистный

Пузыреплодник калинолистный

Это растение родом из Северной Америки, где произрастает в диком виде. Свое название кустарник получил из-за листьев, которые похожи на листья калины.

Для декоративного украшения садового участка используют в основном две группы сортов пузыреплодника калинолистного: растения с красными листьями и с желтой листвой.

В каждой из групп селекционерами выведено множество сортов, на которых стоит остановиться подробнее.

Читайте также: Быстрорастущая многолетняя живая изгородь: выбор растений, правила посадки, выращивания и ухода (Фото & Видео)

Самые популярные краснолистные сорта

Эта группа особо ценится садоводами и дизайнерами за высокие декоративные качества. Листва этих пузыреплодников, окрашенная в разные оттенки красных и пурпурных тонов, выглядит очень празднично. На фоне листьев эффектно смотрятся бело-розовые соцветия летом и гроздья ягод осенью.

Краснолистные сорта предпочитают открытые солнечные участки. В тени они теряют свою «изюминку», поскольку из-за недостатка солнечного цвета яркая пурпурная окраска листьев довольно быстро превращается в обычную зеленую.

«Дьяболо»

Диаболо

Пузыреплодник калинолистный Diabolo – эффектный сорт с темно-пурпурными глянцевыми листьями равномерной окраски и густой пышной кроной.

Мощные кусты растут в высоту до 3 метров и нуждаются в обрезке. С наступлением осени цвет листьев не меняется.

В тени листья становятся зелеными с легким пурпурным оттенком. Сорт награжден премией английского Королевского общества садоводов.

«Ред Барон»

Ред Барон

Куст пузыреплодника Red Baron может имеет красивую шаровидную форму. Он достигает до 2 метров в высоту и столько же в ширину.

Листья этого сорта до 7 см длиной, темно-красного цвета, слегка вытянутые и гофрированные.

С наступлением осени листва приобретает бронзовый оттенок.

«Саммер Вайн»

 

Саммер Вайн

Пузыреплодник Summer Wine имеет крону с раскидистыми ветвями и листву глубокого винного цвета с металлическим блеском.

Куст растет в высоту на 2 метра. Весной цветет пышно, побеги сплошь покрываются бело-розовыми соцветиями.

Этот сорт может хорошо переносить сильные морозы, поэтому пригоден для выращивания практически в любых регионах.

«Леди ин Ред»

Леди ин Ред

Растения этого сорта английской селекции имеют красноватую листву и бледно-розовые цветки. Пузыреплодник Lady in Red не превышает 1,8 метра в высоту.

С наступлением осени нарядная листва сорта «Леди в красном» имеет свойство темнеть.

Декоративные качества этого кустарника были отмечены наградой английского Королевского общества садоводов.

«Андре»

Андре

Пузыреплодник Andre имеет высоту не более 2 метров и такую же ширину. Листья, оранжево-красные при распускании, ближе к началу лета приобретают бронзово-красный оттенок.

Они имеют до 10 см в длину и эллиптическую форму.

Цветет этот сорт в июне кремово-белыми или бледно-розовыми цветками, на месте которых образуются ягоды ярко-красного оттенка.

«Шух»

Шух

Пузыреплодник Schuch имеет листву красно-винного оттенка и цветет в конце весны бело-розовыми цветками.

Кустарник растет в высоту и ширину на 2 метра. Устойчив к морозам и неблагоприятным факторам.

С наступлением осени окраска листвы не меняется.

«Литл Энджел»

Литтл Энджел

Little Angel – низкорослый кустарник, растущий в высоту и ширину до 1 метра. Листья мелкие, имеют размер в 2 раза меньше, чем у высокорослых сортов.

Молодая оранжево-красная листва со временем становится насыщенно-бордовой, с оранжево-красными верхушками побегов.

«Миднайт»

Миднайт

Midnight – самый темный из всех сортов пузыреплодников. Листья взрослого растения имеют практически фиолетово-коричневый цвет.

Цветки розово-белые. Куст средних размеров, достигает 1,8 метра в высоту и 1,5 метра в ширину.

Осенью листья приобретают оранжево-красную расцветку.

«Литл Джокер»

Литтл Джокер

Пузыреплодник Little Joker, выведенный селекционерами Нидерландов, относится к карликовым сортам. Высота куста от 50 см до 1 метра.

Листья мелкие, бордово-пурпурные. С наступлением осени листва приобретает темный пурпурно-коричневый оттенок.

Цветки розовато-белые, появляются в июне. При желании растения этого сорта можно выращивать в контейнерах.

«Тини Вайн»

Тини Вайн

Пузыреплодник Tiny Wine – низкорослый сорт. Растения достигают в высоту до 1,2 метра. Этот кустарник будет прекрасным вариантом для небольших садовых участков.

Темно-бордовых листьев весной практически не видно из-за того, что ветки полностью покрыты большим количеством бело-розовых соцветий.

Осенью листья становятся ярко-красными.

Читайте также: Вейгела: описание, виды и сорта, посадка в открытый грунт и правильный уход за растением (60 Фото & Видео) +Отзывы

Самые популярные желтолистные сорта

Сорта с желтыми или желто-зелеными листьями не менее декоративны, чем краснолистные разновидности пузыреплодника. Они выделяются на фоне темной зелени сада и вносят в ландшафтные композиции свежие и яркие штрихи.

«Лютеус»

Лютеус

Кусты пузыреплодника Luteus вырастают до 3 метров и имеют диаметр кроны до 4 метров. Листья растений этого сорта привлекают своей окраской, которая меняется в течение сезона.

При распускании листва желтая с небольшим оранжевым оттенком, летом она становится желто-зеленой, а с наступлением осени приобретает красивый золотой цвет. Растение зимостойкое.

«Дартс Голд»

Дартс Голд

Высота кустов пузыреплодника Dart’s Gold до 1,5 метра. Листья при распускании оранжево-желтые, летом они становятся желто-зелеными, а осенью приобретают великолепный желто-бронзовый оттенок.

Цветки белые, с легкой розоватой окраской. Сорт удостоен награды английского Королевского общества садоводов.

«Наггет»

Наггет

Кусты пузыреплодника Nugget вырастают до 2 метров. Листья у растений этого сорта относительно мелкие.

При распускании они имеют желтый цвет, но со временем зеленеют. Толстые побеги растут вертикально и формируют вазообразный куст.

«Энис Голд»

Энис Голд

Пузыреплодник Annys Gold – пестролистный сорт. Растение имеет компактный плотный куст с полушаровидной кроной, резную листву, похожую на листья смородины и необычную пеструю окраску.

Желто-зеленые листья будто раскрашены темно-зелеными штрихами, которые образуют неповторимый рисунок.

«Эмбер Джубили»

Эмбер Джубили

Amber Jubilee – пузыреплодник британской селекции, великолепный декоративный сорт. Свое название растение получило в честь Бриллиантового юбилея английской Королевы Елизаветы II.

Куст отличается компактными размерами кроны, не превышающей в высоту и ширину 1,5 метра. Листья этого кустарника с зубчатыми краями.

В течение сезона листва меняет окраску с желтовато-пурпурной сначала на зеленую, а осенью – на оранжевую.

«Ауреа»

Ауреа

Пузыреплодник Aurea достигает в высоту до 2,5 метров. С момента распускания листьев и до начала цветения растение имеет ярко-желтую расцветку листвы.

Затем она немного темнеет, становясь зеленой, а ближе к осени снова приобретает золотисто-желтый оттенок.

Читайте также: Как сделать кашпо для цветов своими руками: уличные, для дома, подвесные | Пошаговые схемы (120+ Оригинальных Фото-идей & Видео)

Сорта с зелеными листьями

Насыщенный зеленый цвет листвы этих растений позволяет комбинировать их при посадке с краснолистными и желтолистными сортами. Оттеняя их необычную окраску, пузыреплодники с зелеными листьями тоже выглядят очень декоративно, особенно во время цветения.

«Нанус»

Нанус

Пузыреплодник Nanus отличается компактной формой. Высота куста обычно составляет до 60 см и редко превышает 1,2 метра.

В ширину куст разрастается до 0,9 метра. Листья имеют темно-зеленый насыщенный оттенок.

С наступлением осени листва желтеет. Цветки розовато-белые.

«Хамелеон»

Хамелеон

Пузыреплодник Chameleon имеет кусты компактной формы высотой всего 1,5 метра и необычную окраску листвы. Темно-зеленые гофрированные листья отличаются красным, оранжевым и желтым отливом.

В молодом возрасте листья имеют пурпурную кайму, а в зрелом – салатовую. Цветет этот сорт кремовыми цветками.

Читайте также: Как сделать детский домик своими руками: из дерева и других материалов. Чертежи с размерами | (80 Фото Идей & Видео)

Пузыреплодник в ландшафтном дизайне

Куст в ландшафтном дизайне

Этот красивоцветущий декоративный кустарник широко применяется в ландшафтном дизайне, в том числе:

  • в одиночных посадках
  • в групповых композициях
  • в качестве живых изгородей

Эффектно выглядят контрастные композиции из комбинации желтолистных и краснолистных сортов пузыреплодника. Например, живая изгородь, выполненная по принципу контраста сортов растений с желтыми и красными листьями.

Живая изгородь из пузыреплодника смотрится очень декоративно, однако требует небольшого ухода, в основном, постоянной обрезки. За это растение порадует меняющимися, в зависимости от времени года, оттенками листвы, красивыми цветками, которые распускаются весной, и красными плодами, созревающими осенью.

Пузыреплодник ценится в ландшафтном дизайне за свою неприхотливость, быстрый рост, разные размеры, от карликовых до высокорослых кустов, и широкую цветовую палитру.

Помимо традиционной зеленой расцветки листья пузыреплодника могут быть окрашены в самые разнообразные тона:

  • желто-зеленый
  • темно-красный
  • красно-оранжевый
  • темно-бордовый
  • золотисто-желтый
  • красно-пурпурный
  • желто-бронзовый
  • пурпурно-фиолетовый
  • красно-коричневый и множество других оттенков

Такая разнообразная цветовая гамма позволяет широко использовать этот кустарник, создавая прекрасные ландшафтные композиции.

Пузыреплодник на участке

Пузыреплодник отлично сочетается:

На его фоне великолепно смотрятся хоста, астильба, наперстянка и другие цветы. Пузыреплодники с контрастной листвой вносят в зеленое убранство сада разнообразие, а в ландшафтный дизайн – колоритные цветовые акценты, которые сохраняют свои яркие оттенки на протяжении всего сезона.

Если вы решите посадить пузыреплодник на своем участке, то не будете разочарованы. Этот кустарник может стать «изюминкой» вашего сада, а уход за ним не составит большого труда. Вырастить это эффектное растение можно даже на неблагоприятных участках со скудными почвами, где другие декоративные культуры будут чувствовать себя некомфортно.

8.7 Total Score

Для нас очень важна обратная связь с нашими читателями. Оставьте свой рейтинг в комментариях с аргументацией Вашего выбора. Благодарим за ваше участие. Ваше мнение будет полезно другим пользователям.

Простота ухода

8

Внешний вид

7.5

Оригинальность

9

Рейтинг пользователей: 4.71 (14 votes)

посадка и уход в открытом грунте, виды и сорта с фото

Листопадный кустарник пузыреплодник (Physocarpus) является представителем семейства розовые. Латинское наименование такого растения состоит из 2 корней древнегреческого языка, а именно: «physo» — «пузырь» и «carpos» — «плод». В данном роду имеется 14 видов. В диких условиях пузыреплодник можно повстречать в Северной Америке и в Восточной Азии. При выращивании в саду данный кустарник отличается своей неприхотливостью, а также тем, что он способен сохранять свой эффектный внешний вид на протяжении всего периода вегетации. Также данный кустарник является быстрорастущим и устойчивым к загазованности воздуха. Такое растение выращивают как одиночное и применяют в ландшафтном дизайне. Однако наиболее эффектно смотрится живая изгородь из пузыреплодника.

Особенности пузыреплодника

Раскидистый кустик пузыреплодника состоит из поникающих веток, которые формируют пышную шарообразную крону. У взрослого кустарника происходит отслаивание коры, причем широкими полосами. В высоту он может достигать 300 сантиметров. Трех-пятилопастные листовые пластины по форме напоминают листочки калины. У простых цветков белого окраса имеется множество тычинок. Они входят в состав соцветий полушаровидной формы, которые в диаметре могут достигать 5–7 сантиметров. Пышное цветение происходит в начале летнего периода. Также довольно эффектно смотрятся и плоды такого растения, они представляют собой вздутые листовки, которые при созревании окрашиваются в красный цвет. Культивируется лишь 2 вида пузыреплодника, при этом есть несколько эффектных сортов, листовые пластины которых обладают различным окрасом.

Живые изгороди: Пузыреплодник калинолистный (Physocarpus opulifolius) ‘Diabolo’ и ‘Luteus’


Watch this video on YouTube

Посадка пузыреплодника в открытый грунт

В какое время сажать

Если в питомнике либо садовом центре вам удалось купить саженцы с закрытой системой корней, их высадку в открытую почву можно будет произвести в любое время года (только не зимой). Если у приобретенных саженцев открытая система корней, то для их посадки следует выбрать весну, а лучше всего осень. Для посадки такого растения подойдет хорошо освещенное, открытое место, рядом с которым не будут расти большие деревья. В том случае, если у сорта окрас листовых пластин зеленый, то такой кустарник сможет нормально расти и на затененном участке. К грунту пузыреплодник не требователен, однако он обязательно должен быть хорошо дренированным, и в его состав должна входить известь. Если же вы хотите, чтобы он имел максимально декоративный вид, тогда следует выбрать рыхлую суглинистую землю, насыщенную питательными веществами.

Как сажать

При подготовке посадочной ямки следует помнить, что ее величина должна быть такой, чтобы в ней смог уместиться слой почвы, насыщенной питательными веществами (либо землесмеси, состоящей из торфа, дерна, земли и песка), при этом у саженца корневая шейка после посадки должна находиться на одном уровне с поверхностью участка. В связи с этим подготовить ямку, выкопав ее и засыпав в нее плодородную почву, рекомендуется за полмесяца до намеченного дня посадки, в этом случае грунт успеет хорошо осесть. Саженец помещают в посадочную ямку вместе земляным комом, при этом помните, что вносить в почву удобрения во время посадки не следует, так как молодое растеньице просто не способно его нормально усвоить. Затем ямку надо будет заполнить почвосмесью (состав описан выше) либо грунтом, насыщенным питательными веществами. Посаженный кустарник нуждается в обильном поливе. Если после полива земля осядет, то нужно будет ее подсыпать. Первые дни следует наблюдать за тем, чтобы приствольный круг пузыреплодника был постоянно немного влажноватым. Поверхность участка следует засыпать слоем мульчи (перегной либо торф).

Уход за пузыреплодником

При уходе за таким растением очень важно его вовремя поливать, так как оно крайне негативно реагирует на засуху. При поливе следите за тем, чтобы жидкость не попадала на поверхность листовых пластин и соцветий, потому что это может привести к появлению ожогов. В связи с этим данную процедуру рекомендуется производить ранним утром либо в вечернее время. Летом в жаркий период полив надо будет осуществлять приблизительно пару раз в неделю, при этом за раз на 1 куст должно уходить 4 ведра воды. Наблюдайте за тем, в каком состоянии находятся листочки пузыреплодника, потому что ему способна навредить не только засуха, но и переувлажнение грунта. В том случае, если участок не засыпан мульчей, то каждый раз после того как кустарник будет полит, надо осуществлять рыхление его поверхности и прополку.

Подкармливать растение надо пару раз в год (в весеннее и осеннее время). В весеннее время подкормить растение надо следующей питательной смесью: на 1 ведро воды берут пятисотграммовую банку коровяка, а также по 1 большой ложке мочевины и аммиачной селитры. На 1 взрослый куст берется 1,5 ведра такого раствора. В осеннее время под каждый кустик следует вылить по полтора ведра питательного раствора, состоящего из 10 литров воды и 2 больших ложек нитроаммофоски.

Обрезка

Данному кустарнику необходима систематическая санитарная и формирующая обрезка. В весеннее время следует обязательно произвести обрезку в санитарных целях, для этого срезаются все травмированные, пораженные болезнью, пострадавшие от мороза стебли и ветви, а также те, что растут внутрь куста. Обрезая пузыреплодник в осеннее время, вы подготавливаете его к предстоящей зиме. Обрезку с целью формирования кроны можно произвести осенью, но опытные садоводы рекомендуют заняться ею весной. Для того чтобы кустик обладал формой фонтана, нужно срезать все тоненькие стебли у основания, оставив 5 либо 6 наиболее мощных, которые надо немного укоротить. Если же вы хотите, чтобы куст был широким, его нужно срезать на высоте 50 сантиметров. Когда кустарнику исполнится 6 лет, производят омолаживающую обрезку на пень. На толстых стеблях места срезов следует намазать садовым варом.

Пересадка

В некоторых случаях возникает необходимость в пересадке данного растения, к примеру, вам необходимо перенести его на другое место. Если кустарник уже взрослый, то пересадить его следует в начале весны, до того как набухнут почки, либо в осеннее время, когда окончится листопад. Куст пересаживают с достаточно объемным земляным комом, при этом сначала ему делают обрезку, во время которой срезают травмированные, пораженные болезнью и загущающие стебли, а оставшиеся следует укоротить до 0,2–0,3 м. Благодаря этому вам удастся сделать нагрузку на систему корней более слабой, потому что во время адаптации ей будет крайне сложно кормить взрослое растение. Пересадка производится практически так же, как и посадка, только следует учесть, что пузыреплодник в этом случае уже взрослый. Пересаженный куст надо полить, используя для этого раствор Гетероауксина либо Корневина, а еще нужно опрыскать листовые пластины Эпином либо Экогель-антистрессом.

Заболевания и вредители

Посадить и вырастить пузыреплодник довольно просто, а еще садовода порадует то, что он обладает очень высокой устойчивостью к вредителям и различным заболеваниям. Однако в том случае, если в почве не будет доставать питательных веществ, то у растения происходит развитие хлороза, из-за чего усыхают верхушечные стебли и желтеют молоденькие листовые пластины. Если вы заметили признаки данного заболевания, то следует произвести опрыскивание листвы либо полив самого куста под корень раствором Феррилена, Антихлороза, Феровита, но опытные садоводы рекомендуют воспользоваться Хелатом железа. Как правило, после данной процедуры пузыреплодник очень быстро восстанавливается.

Размножение пузыреплодника

Пузыреплодник можно достаточно легко размножить вегетативным способом, а именно: черенкованием, отводками, а также делением куста. Также для этого подойдет и генеративный (семенной) способ размножения. Высев семян производят в весеннее либо осеннее время, при этом для начала их надо стратифицировать в течение 30 дней. Однако следует знать, что выращенные таким образом кустарники редко сохраняют насыщенный окрас листьев, который присущ родительскому растению. А еще выращивание пузыреплодника из семян достаточно трудозатратный процесс. В связи с этим для его размножения рекомендуется прибегнуть именно к вегетативным способам.

Черенкование

Заготовку черенков следует производить до того, как куст зацветет. Для этого срезают зеленые побеги нынешнего года. Длина черенков может быть от 10 до 20 сантиметров, и на каждом из них должно присутствовать по 2 либо 3 междоузлия. Все листовые пластины, находящиеся внизу черенка, надо срезать, а те, что располагаются вверху — укорачивают на ½ часть. Подготовленные черенки надо погрузить в раствор средства, стимулирующего корнеобразование (например, Корневин). Затем их высаживают в учебную грядку в землесмесь, состоящую из торфа и песка. Производят их полив и накрывают пленкой из полиэтилена. Ухаживать за черенками очень просто, их надо вовремя поливать и систематически проветривать. В зимнее время укоренившиеся черенки нуждаются в укрытии, а уже весной их можно будет посадить на постоянное место.

Как размножить отводками

Данный метод размножения является наиболее простым и эффективным. В весеннее время следует отобрать наиболее мощный и абсолютно здоровый побег, который должен обязательно расти наружу. С него следует оборвать все листовые пластины, оставив лишь растущие на самом верху. Затем этот стебель укладывается в заранее подготовленную канавку, глубина которой должна быть около 12 сантиметров, далее его фиксируют, используя для этого скобу из дерева (можно взять шпильки для волос), потом канавку надо заполнить грунтом. На протяжении всего периода вегетации отводок будет нуждаться в своевременном поливе, прополке и рыхлении поверхности почвы. К наступлению осеннего периода отводок должен будет дать корни, и его надо отделить от родительского кустика и укрыть на зимовку.

Как размножить делением куста

Делением куста лучше всего размножать пузыреплодник калинолистный. Производят данную процедуру в весеннее либо осеннее время. Однако если у вас есть опыт и определенные навыки в этом деле, то поделить куст можно и летом. Чтобы данная процедура закончилась успешно, ее надо провести очень быстро, потому что корневая система, оказавшаяся на свежем воздухе, ни в коем случае не должна подсохнуть.

Пузыреплодник зимой

Уход в осеннее время

В осенний период данный кустарник выглядит особенно эффектно, ведь именно в это время листва окрашивается в различные цвета. Он обладает сравнительно высокой морозоустойчивостью и в зимнее время, как правило, замерзают лишь те ветви, которые не успели вызреть. Но следует учесть что укоренившиеся черенки как и молоденькие экземпляры нуждаются в укрытии на зиму.

Подготовка к зимовке

В том случае если синоптики предвещают очень морозную зиму то укрыть следует и взрослые кусты пузыреплодника. Для этого надо аккуратно стянуть кустарник шпагатом, а потом «надеть» на него конус из рубероида либо неплотно обмотать его лутрасилом. Однако для начала надо засыпать поверхность приствольного круга слоем мульчи (торфом), толщина которого должна быть от 5 до 8 сантиметров. Молодые кустарники надо обрезать, замульчировать их приствольный круг, а затем накрыть лапником.

Виды и сорта пузыреплодника с фото и названиями

На данный момент культивируется только 2 вида пузыреплодника, а еще их сорта и разновидности.

Пузыреплодник амурский (Physocarpus amurensis)

Это вид в природных условиях можно повстречать в Северной Корее, Северном Китае и на Дальнем Востоке, при этом он предпочитает расти в смешанных лесах. Высота такого кустарника с кроной шаровидной формы около 300 сантиметров. Молоденькие стебли коричневато-красные и гладкие, при этом на старых стволах происходит отслаивание коры продольными полосками. Трех-пятилопастная листовая пластина обладает сердцевидным основанием и длиной около 10 сантиметров. Лицевая поверхность у них темно-зеленая, а изнаночная — белесовато-серая, потому что на ней располагаются звездчатые войлочные волоски. Соцветия щитковидной формы состоят из 10–15 белых цветочков, обладающих полутора сантиметровым диаметром. Цветение длится примерно 20 дней. Плод представляет собой вздутую листовку, которая при созревании становится красной. Этот вид отличается высокой морозоустойчивостью. Его применяют для создания живых изгородей, а также в групповых и одиночных посадках. Культивируется с 1854 г. Наиболее популярные формы:

  1. Лютеус. Летом листовые пластины окрашены в насыщенно-желтый цвет, а в осеннее время они становятся бронзовыми.
  2. Ауреомаргината. На листовых пластинах имеется окантовка темно-золотистого окраса.
  3. Нана. У такого карликового кустарника темно-зеленые однотонные листовые пластины.

Пузыреплодник калинолистный (Physocarpus opulifolius)

Родина такого вида восточная часть Северной Америке, при этом он предпочитает расти в подлесках и на речных берегах. Этот кустарник с полушаровидной пышной кроной в высоту может достигать 300 сантиметров. Эллиптические трех-пятилопастные листовые пластины имеют вытянутую большую среднюю долю и зубчатую кромку. Лицевая поверхность у них зеленая, а изнаночная — окрашена в более бледный оттенок, иногда она может быть опушенной. Мелкие (диаметр около 1,2 см) цветочки обладают розовым либо белым окрасом, и тычинками красного цвета. Плод представляет собой вздутую сборную бледно-зеленую листовку, которая при созревании становится красной. Данный вид можно применять для создания живой изгороди, а также в одиночных либо групповых посадках. Культивируется с 1864 г. Наиболее популярные сорта:

  1. Дартс Голд. Высота плотного и широкого куста может доходить до 150 сантиметров. Желтые листовые пластины в летнее время становятся зеленовато-желтыми. Кистевидные соцветия состоят из белых либо розовых цветков.
  2. Диабло (краснолистный). Высота куста около 300 сантиметров. Окрас его листвы пурпурный либо темно-красный. Если куст растить в затененном месте, то его листочки будут зелеными с пурпурным отливом, а при выращивании в солнечном месте, они обладают красным окрасом. В осеннее время окрас листвы не изменяется. Данный сорт является наиболее популярным.
  3. Рэд Барон. Высота куста около 200 сантиметров. Голые овальные трех-пятилопастные листовые пластины в длину достигают 7 сантиметров и имеют зубчатую кромку. Они окрашены в эффектный темно-красный цвет и являются более узкими по сравнению с пузыреплодником Диабло. Зонтиковидные соцветия состоят из белых с розовым отливом цветочков, достигающих в диаметре 5 сантиметров. Также довольно эффектно смотрятся и плоды красного цвета, в состав которых входит от 3 до 5 остроконечных мешочков. Данный сорт входит в число наиболее ценных.
  4. Леди ин Рэд. Куст в высоту может достигать 150 сантиметров. Данный сорт выведен селекционерами из Англии. Листочки насыщенно-красного окраса постепенно темнеют. Окрас нежных цветочков бело-розовый.

Сорта пузыреплодника калинолистного. Обзор сортов, посадка и уход.


Watch this video on YouTube

описание, посадка и уход, фото, отзывы

Пузыреплодник Ред Барон по праву считается одним из самых оригинальных кустарников. Садоводам он приглянулся не только за необыкновенный и шикарный внешний вид, но и за неприхотливость в уходе. Ред Барон быстро растет, сохраняя при этом свою декоративность на протяжении всего вегетационного периода, поэтому широко используется для озеленения городских парков и частных домовладений.

Описание пузыреплодника Ред Барон

Пузыреплодник Ред Барон был привезен из Северной Америки, где он чаще всего произрастает на речных берегах. Куст высокорослый, относится к калинолистному виду. Его пятилопастные листья очень напоминают калиновые листья. Период цветения начинается в июне-июле. В начале сентября вызревают плоды.

Описание пузыреплодника калинолистного Ред Барон

Высота

около 2 м

Форма куста

округлая, раскидистая

Ветви

дугообразные

Цветы

бело-розовые с красной тычинкой, собранные в соцветия, полушарообразной, щитковидной формы

Плоды

сборные, красные вздутые листовки

Листья

5-7 лопастные, 7-10 см в диаметре, округло-эллиптической формы, темно-красного цвета, который осенью становиться бронзовым, в тени листва зеленая, с красноватым оттенком

Пузыреплодник Ред Барон в ландшафтном дизайне

Ред Барон пользуется популярностью у ландшафтных дизайнеров, благодаря его необыкновенному внешнему виду. Декоративными являются все его части, и листва, и цветы, и плоды. Встретить пузыреплодник можно и на городских улицах, и в сельских дворах. Украшают этим ярким кустарником парковые зоны, парадные входы, дачные участки.

Зачастую Ред Барон становится элементом сложных садовых композиций, в которых он может занимать как главенствующие позиции, так и выступать фоном для других растений. Куст пузыреплодника может быть отличным солитером в подлесках, на фоне лиственных и хвойных композиций.

Прекрасно смотрится Ред Барон в одиночных и групповых газонных посадках. Оригинальным дизайнерским решением является стрижка кустов. При этом пузыреплодник получает уникальную форму, что в сочетании с другими садовыми культурами дает потрясающий эффект.

Живые изгороди из пузыреплодника Ред Барон (на фото) могут достойно украсить любую зону отдыха или сад, загородного дома. Получаются они плотными, густыми и невероятно красивыми, не требующими при этом особого ухода.

Условия выращивания пузыреплодника Ред Барон

Особенности выращивания пузыреплодника калинолистного Red Baron практически такие же, как и у других разновидностей пузыреплодников. Ред Барон – довольно неприхотливое растение, которое предпочитает солнечные участки, но может расти и в полутени. Пузыреплодник, произрастающий в солнечных местах, получает возможность полностью раскрыть декоративные качества своей листвы. Тогда как в тени она приобретает зеленый цвет, насыщенность которого зависит от степени освещенности.

Посадка и уход за пузыреплодником Ред Барон

Пузыреплодник Ред Барон, согласно описанию сорта, не нуждается в каком-либо специализированном уходе, но полноценно развиваться будет лишь при проведении следующих агротехнических мероприятий.

Полив

2-3 раза в неделю, особенно в жаркий период

Подкормка

в весенне-осенний сезон

Рыхление прикорневого круга

регулярно, соблюдая осторожность, чтобы не повредить корневую систему

 

Обработка почвы от вредителей

весной в профилактических целях

Обрезка

2 раза в год

Важно! Высаживание посадочного материала с открытой корневой системой рекомендуется проводить ранней весной (до распускания почек) или осенью (в сентябре). Растения в горшочках или контейнерах можно сажать на протяжении всего сезона вегетации.

Подготовка посадочного участка

Участок для посадки пузыреплодника Ред Барон рекомендуется выбирать с рыхлой почвой, богатой на питательные вещества. Но ввиду своей нетребовательности, пузыреплодник будет произрастать и на недостаточно плодородных субстратах. Состав грунта может быть абсолютно разным, главное, чтобы в нем отсутствовала известь. Также довольно плохо пузыреплодник развивается на почвах с высоким залеганием грунтовых вод.

Правила посадки

Посадка пузыреплодника Ред Барон начинается с подготовки посадочной ямы для саженца. Пошаговый процесс подготовительных и посадочных работ:

  1. Выкопать яму достаточной глубины (корневая шейка должна находиться вровень с грунтом).
  2. На дно поместить слой питательного, плодородного грунта.
  3. Расположить саженец в ямке вертикально.
  4. Присыпать корень землей, слегка утрамбовав.
  5. Полить саженец.
  6. Через три-четыре дня провести рыхление грунта.
  7. Замульчировать прикорневую зону торфом, перегноем или сухой землей, с целью сохранения влаги.

Совет! Оптимальный грунт для посадки пузыреплодника калинолистного Ред Барон, как и для любых других декоративных растений, должен быть многокомпонентным.

Ветки саженца при посадке не следует заглублять в землю более чем на 1-2 см. Через некоторое время после усадки грунт необходимо подсыпать, чтобы сравнять поверхность. Окучивание проводить не рекомендуется.

При высаживании пузыреплодника Ред Барон, с целью создания живой изгороди, саженцы следует размещать в шахматном порядке (двухрядным способом).

Рекомендуемое расстояние:

  • в рядах – 35 см;
  • между саженцами – 45 см.

Полив и подкормка

Частота полива кустов пузыреплодника Ред Барон зависит от ряда факторов, таких как:

  • вид грунта;
  • возраст растения;
  • климатический регион, в котором произрастает кустарник.

Совет! При выращивании пузыреплодника на легких суглинках в районах с жарким летом поливать насаждения рекомендуется с конца весны до наступления осеннего сезона. Не следует злоупотреблять поливами на газонах или тяжелых глинистых почвах. При переувлажнении возрастает риск возникновения мучнистой росы, которая может быть губительна для растений.

Поливать декоративные кусты сорта Ред Барон следует регулярно, с периодичностью 2-3 раза в неделю. Норма расхода воды на одно растение составляет около 40 л.

Подкармливать пузыреплодник калинолистный необходимо:

  • ранней весной – азотными удобрениями;
  • осенью – минеральными.

 Подкормка (на 10 л воды)

весной

осенью

·        коровяк – 500 мл;

·        карбамид (мочевина) – 25 г;

·        нитрат аммония – 25 г.

·        коровяк – 500 мл;

·        карбамид (мочевина) – 25 мл;

·        нитрат аммония – 25 мл;

·        нитрат фосфора – 50 мл.

Совет! Норма расхода подкармливающего раствора на 1 взрослый куст (15-20 лет) – 15 л.

Обрезка

Пузыреплодник калинолистный Ред Барон является быстрорастущим сортом. Произрастая в комфортных условиях, куст может за год дать около 40 см прироста и в ширину, и в высоту. Поэтому растение нуждается не только в санитарной обрезке, но и в формирующей. Процедура не является для растения травмирующей. Кусты легко ее переносят и очень быстро пускают новые побеги.

Санитарная обрезка проводиться весной. Ее основная цель – удаление сломанных и подмерзших ветвей. Кустоформирующая обрезка помогает придать кустарнику необходимую форму и стимулирует ветвление. Проводят ее в весенний период (до распускания почек) или осенью (после окончания вегетации).

Ред Барон, как и другие разновидности пузыреплодников, растет фонтанообразно, а правильно проведенная формирующая обрезка способствует активизации процессов роста верхних почек. Проводить кроноформирующую обрезку можно двумя способами:

  1. Стволы куста обрезают на высоте 40-50 см, чтобы получить мощный, широкий куст.
  2. У основания кустарника удаляются все тонкие и слабые побеги. Оставляют около пяти самых крепких стволов, обрезая их на высоте 1,5 м, стимулируя тем самым их рост. Куст приобретает при этом выраженную фонтанообразную форму.

Подготовка к зиме

Пузыреплодник Красный Барон устойчив к незначительному принижению атмосферных температур, но в суровые зимы молодые побеги иногда могут подмерзать. С целью предотвращения возможного вымерзания, кусты осенью следует правильно подготовить к зимовке. Начинать проведение подготовительных работ рекомендуется с приходом первых холодных ночей.

Поэтапный план утепления пузыреплодника калинолистного:

  1. Кусты стягиваются веревкой или шпагатом.
  2. Вокруг ствола растения раскладывается стружка или торф.
  3. Кустарник укрывается сверху любым натуральным утепляющим материалом.

Совет! Обязательно укрывать на зиму необходимо саженцы и молодые кусты пузыреплодника Red Baron.

Размножение пузыреплодника калинолистного Red Baron

Размножается пузыреплодник калинолистный Ред Барон:

  • отводками;
  • черенками;
  • делением куста.

Предупреждение! Не рекомендуется выращивать пузыреплодник калинолистный Ред Барон с помощью собственноручно собранных семян, так как можно получить растения, не имеющие характерных декоративных особенностей. При семенном размножении оригинальный окрас передается не всегда.

Хорошие результаты дает размножение пузыреплодника отводками. Для отводков на взрослых кустах отбирают сильные, здоровые побеги, растущие наружу. Перед закладыванием с них удаляют всю листву, за исключением верхушки. Затем делают канавку глубиной 15 см, в которую укладывают подготовленный побег. Обязательно отводок следует закрепить, пришпилив его к земле, например, деревянными или металлическими скобками. Сверху ямку необходимо засыпать землей. Осенью отводок отделяют от куста и высаживают на постоянное место.

Черенки для размножения подготавливают таким образом:

  1. Перед началом цветения с кустов срезаются молодые ветки длиной не менее 20 см.
  2. С нижней части побега удаляются листья, а оставшиеся укорачиваются вдвое.
  3. Ветки помещают в раствор «Корневина» на 2-3 дня.
  4. При появлении первых признаков образования будущей корневой системы черенки высаживают в питательный грунт.
  5. Саженцы на лето укрывают пленкой, периодически проветривая и поливая. На зиму утепляют.

Внимание! Побеги, которые отбираются для размножения, обязательно должны иметь 2-3 почечных междоузлия. Почва для их высадки по составу должна быть схожа с грунтом, в котором в дальнейшем будет произрастать кустарник.

Деление куста является самым быстрым способом размножения. Но в связи с тем, что взрослые кусты имеют сильно развитую корневую систему, такой вариант является довольно трудоемким.

Болезни и вредители

Пузыреплодник Ред Барон отличается высокой устойчивостью ко многим заболеваниям и вредителям. Но с профилактической целью рекомендуется проводить весеннюю обработку почвы противогрибковыми и бактериальными препаратами. Такая процедура будет способствовать лучшему развитию кустарника и его росту.

В гигиенических целях в воду для полива рекомендуется добавлять такие препараты, как «Фитоспорин», «Алирин», «Гамаир». Дозировка прописана в инструкции к каждому конкретному средству. Полив проводят весной, и одной такой профилактической процедуры достаточно для защиты растений на весь вегетационный период.

Иногда кусты пузыреплодника Ред Барон могут поражаться порозом. Заболевание развивается при произрастании растений на бедных почвах. В частности его провоцирует недостаток железа в грунте. Характерным признаком заболевания является ржавый цвет молодых листьев и побегов, с последующим их усыханием. Ликвидировать причину болезни можно прикорневым поливом кустов железосодержащими препаратами («Фиролитам», «Филат железа»).

Заключение

Пузыреплодник Ред Барон выгодно выделяется среди большинства садовых растений, своей неприхотливостью и отличными декоративными качествами. Растение очень шикарно смотрится в саду, украшая его своими листьями, меняющими цвет в зависимости от времени года, красивыми весенними цветами и осенними ягодами.

Отзывы о пузыреплоднике Ред Барон

Татьяна, 45 лет, Москва

Пузыреплодник калинолистный Ред Барон считаю настоящим украшением сада. Даже в одиночестве он смотрится просто шикарно. Очень нравиться мне, что кустарник сохраняет свой красивый внешний вид с начала весны до поздней осени. В уходе пузыреплодник не требователен, размножается легко, поэтому его выращиванием могут заниматься даже садоводы-новички.

Ольга, 39 лет, Сахалин

На моем приусадебном участке много декоративных кустарников и среди них особое место занимает пузыреплодник Ред Барон. Посадила его с целью создания живой изгороди и не разочаровалась. Растут кусты очень быстро, поэтому не пришлось долго ждать результат. Ухаживать за ними не хлопотно – стригу 2 раза в год, но процедура эта не сложная и не трудоемкая. Потратив немного сил и времени можно получить не только эффективную, но еще и очень красивую изгородь.

Популярные виды и сорта пузыреплодника с фото и описанием

Наверняка каждый хоть раз в жизни встречал этот эффектный и одновременно нежный кустарник с забавным названием «пузыреплодник». Описание сортов этого растения – в нашем материале.

Известно около 14 видов этого декоративного листопадного кустарника. Род Пузыреплодник (Physocarpus) выращивают в наших широтах с 1793 г. (первое упоминание в каталогах Санкт-Петербургского ботанического сада). В настоящее время пышные кусты разных сортов пузыреплодника можно встретить не только в садах приусадебных участков, но и в городских парках.

Это неприхотливый, морозостойкий кустарник. Часто пузыреплодник используют в качестве живой изгороди, высаживая кусты вдоль железнодорожных магистралей.

Пузыреплодник калинолистный

Куст пузыреплодника калинолистного может достигать 3 м в высоту и столько же в диаметре. Ветви раскидистые, крона полушаровидная, густая. Диаметр цветков – до 1,2 см, окраска лепестков белая или розовая (возможны смешанные оттенки). Листьям с зубчатыми краями характерна эффектная окраска: от золотистой до темно-пурпурной. Вид известен с 1864 г.

Теневыносливый вид, но чтобы сохранять окраску листьев и цветов, ему необходимо достаточное количество солнечного света. В регионах с суровыми зимами пузыреплодник необходимо укрывать на зимний период.

Дартс Голд (Dart’s Gold)

Эффектный кустарник с декоративными листьями ярко-желтой окраски, нежными цветами и плодами украшает участок на протяжении всего сезона.

 
Окраска лепестков Высота куста (см) Ширина куста (см) Сроки цветения
 Розовато-белая  150  150  Июнь-июль

Лютеус (Luteus)

Пузыреплодник сорта Лютеус прекрасно подходит для оформления живых изгородей, хорошо смотрится в контрастных посадках за счет листвы, окрашенной в желто-оранжевые цвета.

 
Окраска лепестков Высота куста (см) Ширина куста (см) Сроки цветения
 Белая  300  300  Июнь-июль

Ред Барон (Red Baron)

Этот сорта пузыреплодника идеален и для одиночных, и для многоуровневых посадок. Полушаровидная крона с нежно-розовыми соцветиями и темно-красной листвой отлично дополняет живую изгородь.

 

Окраска лепестков Высота куста (см) Ширина куста (см) Сроки цветения
 Бледно-розовая  200  200  Июнь-июль

 Диабло (Diabolo)

Пузыреплодник Диабло (Диаболо) завораживает насыщенным темно-пурпурным оттенком листвы. Притягивает к себе внимание как в солитерной посадке, так и в живой изгороди.

 
Окраска лепестков Высота куста (см) Ширина куста (см) Сроки цветения
 Бледно-розовая  300  300  Июнь-июль

Саммер Вайн (Summer Wine)

Окраска листьев пузыреплодника сорта Саммер Вайн напоминает цвет красного вина. В тени листва может слегка позеленеть, но это не снижает декоративности куста.

 
Окраска лепестков Высота куста (см) Ширина куста (см) Сроки цветения
 Розово-белая  200  200  Июнь-июль

 Леди ин Ред (Lady in Red)

Пузыреплодник Леди ин Ред – сорт относительно новый. Эффектные морщинистые листья имеют красный, вплоть до свекольного, оттенок.

 

Окраска лепестков Высота куста (см) Ширина куста (см) Сроки цветения
 Бело-розовая  150  120  Июнь

Литл Девил (Little Devil)

Темно-бордовые кусты пузыреплодника этого сорта могут служить яркими пятнами в контрастных композициях. Литл Девил отличается неприхотливостью и стойкостью.

 

Окраска лепестков Высота куста (см) Ширина куста (см) Сроки цветения
 Бледно-розовая  100  100  Июнь-июль

Литл Энджел (Little Angel) 

Листья пузыреплодника сорта Литл Энджел очень мелкие, с бордовым оттенком. Куст компактный, невысокий, хорошо смотрится в контейнерных посадках.

 

Окраска лепестков Высота куста (см) Ширина куста (см) Сроки цветения
 Розовато-белая  100  100  Июнь-июль

Литл Джокер (Little Joker)

Этот кустарник с листвой вишневого цвета хорошо переносит заморозки. Как и другие низкорослые сорта пузыреплодника, подходит для выращивания в контейнерах.

 

Окраска лепестков Высота куста (см) Ширина куста (см) Сроки цветения
 Розовато-белая  90-100  100  Июнь

Пузыреплодник амурский

Высота кустарников этого вида достигает 3 м в высоту. У широкой раскидистой кроны шаровидная форма. Листья обычно темно-зеленого цвета, цветки белые (до 1,5 см в диаметре). Пузыреплодник амурский в ландшафтном дизайне традиционно используется в групповых и одиночных посадках. Не уступает калинолистному в неприхотливости и зимостойкости.

Ауреомаргината (Aureomarginata)

Золотисто-темная кайма на зеленых листьях пузыреплодника этого сорта придает кустарнику очарование. Оригинальный вид куста освежает сад, привлекает внимание.

 

Окраска лепестков Высота куста (см) Ширина куста (см) Сроки цветения
 Белая  250  200  Июнь

Нана (Nana)

Это низкорослый сорт пузыреплодника амурского. Темно-зеленые листья формируют компактную крону. Применяют в сложных композициях и в солитерных посадках на небольших участках.

 

Окраска лепестков Высота куста (см) Ширина куста (см) Сроки цветения
 Бело-розовая  100-120  100-120  Июнь

Если вы в поисках красивых и необычных декоративных кустарников, обратите внимание на Снежеягодник

 

 

Что это такое, как это лечится и многое другое

Везикула — это небольшой пузырь, заполненный жидкостью. Его размер может варьироваться от точной точки до 5 миллиметров, что примерно равно размеру ластика для карандашей. Везикулярная сыпь возникает, когда в области высыпаний есть пузырьки. Большинство везикулярных высыпаний безвредны и быстро проходят, но есть некоторые серьезные заболевания, которые могут вызывать везикулярные высыпания.

Что вызывает везикулярную сыпь?

Существует множество состояний, которые могут вызывать везикулярную сыпь.Некоторые из них включают:

Физические и химические причины. Эта категория включает сыпь, возникающую в результате таких проблем, как воздействие элементов, химикатов или яда насекомых.

Тепловая сыпь возникает, когда у вас закупорены поры, задерживающие пот под кожей. Обычно это происходит в жаркую и влажную погоду. У младенцев сыпь обычно появляется на шее, плечах и груди. У взрослых это обычно в складках кожи и местах, где одежда натирает. Обычно это проходит само по себе, но в тяжелых случаях может потребоваться медицинская помощь.

Обморожение — это небольшие зудящие пятна, которые обычно появляются на пальцах рук или ног после воздействия холодной, но не морозной погоды. Обычно они появляются через несколько часов после пребывания на холоде. Обычно они проходят сами по себе, но в противном случае вам может потребоваться обратиться к врачу.

Полиморфная светлая сыпь — сыпь, появляющаяся у людей с повышенной чувствительностью к солнцу. Обычно это происходит после первого пребывания на солнце в году, весной или в начале лета.Он появляется примерно через 30 минут после пребывания на солнце, часто на участках тела, закрытых зимой, таких как руки и верхняя часть груди. Обычно проходит самостоятельно в течение 10 дней.

Бактериальные и вирусные причины. Везикулярные высыпания, вызванные вирусами и бактериями, часто сопровождаются лихорадкой. Бактериальные заболевания, которые могут вызывать везикулярную сыпь, включают:

Вирусные заболевания, которые могут вызывать везикулярную сыпь, включают:

Контактный дерматит. Контактный дерматит — это везикулярная сыпь, которая возникает после контакта с чем-то, на что у вас аллергия или что вас раздражает. Раздражающий контактный дерматит является наиболее распространенным типом. Это может произойти у любого человека и часто происходит после многократного воздействия. Мыло, моющие средства, моча, стул, слюна и растворители являются распространенными причинами раздражающего дерматита.

Аллергический дерматит возникает, когда вы подвергаетесь воздействию чего-то, на что у вас аллергия, например ядовитого плюща, косметики, продуктов питания или красителей. Сыпь обычно появляется в течение нескольких часов после воздействия.Хронический контактный дерматит может развиться в утолщенную, шелушащуюся кожу.

Редкие причины. Существуют и другие редкие заболевания, которые могут вызывать везикулярную сыпь, например аутоиммунные заболевания с образованием пузырей. Это происходит, когда ваше тело ошибочно атакует здоровые ткани. Лекарства нет, но эти заболевания часто можно контролировать с помощью лечения. Без лечения они могут вызвать опасные для жизни осложнения.

Как диагностируется везикулярная сыпь?

Ваш врач выслушает ваши симптомы и задаст вам вопросы о том, как и когда появилась сыпь.Они проведут медицинский осмотр и осмотрят вашу сыпь. Этого может быть достаточно для постановки диагноза или могут потребоваться дополнительные анализы. Они могут сделать анализ крови или соскоблить немного кожи с сыпи для биопсии.

Как лечить везикулярную сыпь?

Лечение вашей сыпи будет зависеть от причины, но может включать:

Многие везикулярные высыпания проходят сами по себе или при домашнем лечении. Если сыпь зудит, могут помочь следующие домашние средства:

  • Примите ванну с овсянкой.
  • Увлажните кожу с помощью увлажняющего крема без отдушек и добавок.
  • Прикладывайте холодный компресс или холодное влажное полотенце к зудящим областям.
  • Используйте местный анестетик, содержащий прамоксин.
  • Используйте охлаждающий лосьон, такой как каламин или ментол.
  • Охладите увлажняющий крем для охлаждающего эффекта.

Чтобы предотвратить зуд, дерматологи рекомендуют следующие советы:

  • Держите воду теплой, а не горячей.
  • Используйте средства по уходу за кожей без отдушек.
  • Избегайте экстремальных температур.
  • Носите свободную, удобную одежду.
  • Уменьшите стресс.
  • Кожные волдыри | ДермНет NZ

    Автор: д-р Аманда Окли, дерматолог, Гамильтон, Новая Зеландия, 1997 г. Обновлено в сентябре 2015 г. 


    Что такое пузырчатая болезнь?

    Пузырчатая болезнь — это состояние, при котором имеются поражения кожи, заполненные жидкостью.

    • Везикулы представляют собой небольшие пузыри диаметром менее 5 мм.
    • Булла – это более крупный волдырь. Обратите внимание, что множественное число слова булла — это буллы.
    • Волдыри могут лопнуть или верхушка волдыря может отслоиться, образуя эрозию. Экссудация серозной жидкости образует корки.

    Пузырчатые болезни

    Острые заболевания с образованием пузырей

    Острые заболевания с образованием пузырей могут быть генерализованными или локализованными в одном участке тела и быть вызваны инфекцией или воспалительными заболеваниями.Хотя чаще всего это экзема, генерализованные острые волдыри могут быть опасными для жизни и часто требуют госпитализации.

     Острые состояния, связанные с образованием волдырей, следует исследовать путем взятия мазков на культуру бактерий и вирусов. Биопсия кожи может помочь в постановке диагноза.

    Острые генерализованные пузырчатые заболевания

    Острый фебрильный нейтрофильный дерматоз

    Атипичная энтеровирусная инфекция

    Ветряная оспа/ветряная оспа

    • Детские болезни; более серьезные у взрослых
    • Кожа головы, лицо, слизистая оболочка рта, туловище
    • Культура/ПЦР Вирус ветряной оспы

    Герпетическая экзема

    Дерматит

    Полиморфная световая сыпь

    • Поражает участки тела, подверженные воздействию солнца (руки, верхняя часть груди, ступни
    • Папулы, бляшки, иногда мишеневидные
    • Майская запасная сторона
    • Возникает в течение нескольких часов после воздействия яркого солнечного света

    Многоформная эритема

    • Реакция, например, на инфекцию
    • Острая сыпь в виде папул, бляшек, целевых поражений
    • Акральное распределение: щеки, локти, колени, кисти, стопы
    • Может быть мукозит (губы, конъюнктива, гениталии)

    Синдром Стивенса-Джонсона/токсический эпидермальный некролиз

    • Пациент очень плохо себя чувствует
    • Вовлечение слизистой оболочки
    • Почти всегда вызвано употреблением наркотиков
    • Редко из-за микоплазменной инфекции
    • Болезненная красная кожа может отслаиваться пластами или иметь множественные сливающиеся волдыри

    Синдром гиперчувствительности к лекарственным средствам 

    • Прием препарата начался за 8 недель до начала заболевания
    • Кореподобная сыпь с образованием пузырей (без некролиза)
    • Частое поражение слизистой оболочки
    • Полиорганное поражение (почечное, печеночное, респираторное, гематологическое)
    • Часто выраженная эозинофилия

    Стафилококковый синдром ошпаренной кожи

    Острые локализованные волдыри

    Острый дерматит

    Буллезное импетиго

    Обморожение

    • Воздействие холода
    • Пурпурные зудящие/жгучие бляшки

    Энтеровирусный везикулярный стоматит

    Проходит через несколько дней

    Рожистое воспаление

    Фиксированная лекарственная сыпь

    • Повторяющаяся сыпь, обычно на одном и том же месте
    • Из-за периодического приема препарата в течение 24 часов после появления сыпи
    • Единичные или несколько поражений
    • Центральный блистер

    Herpes simplex

    • Мономорфный пупковидный
    • Культура/ПЦР Вирус простого герпеса

    Опоясывающий герпес (опоясывающий лишай) 

    • Кожное распространение
    • Культура/ПЦР Вирус ветряной оспы

    Укусы и укусы насекомых

    Милиария 

    • Центральный ствол
    • Потливость
    • Везикулы очень поверхностные

    Некротический фасциит

    Транзиторный акантолитический дерматоз

    • Острый или хронический
    • Пожилые мужчины
    • Зуд или бессимптомное течение
    • Покрытые коркой папулы

    Травма

    Хронические пузырчатые заболевания

    Диагностика хронических пузырчатых заболеваний часто требует биопсии кожи для гистопатологии и прямой иммунофлуоресценции.Анализ крови на специфические антитела (непрямая иммунофлуоресценция) также может оказаться полезным при постановке диагноза иммунобуллезной болезни.

    Буллезный эпидермолиз 

    • Различные типы, включая приобретенные и генетические формы
    • Начало при рождении или в раннем детстве

    Fogo selvagem

    • Также называется эндемической листовидной пузырчаткой
    • Начало в детстве или подростковом возрасте

    Мастоцитоз

    • Различные типы
    • Часто начинается в детстве

    Доброкачественная семейная пузырчатка

    • Также называется болезнью Хейли-Хейли
    • Ограничено изгибами

    Пузырьковые генодерматозы

    Буллезная системная красная волчанка

    • Пациент с системной красной волчанкой
    • Субэпидермальные буллы

    Буллезный пемфигоид 

    • Преимущественно кожный (реже слизистый)
    • В основном поражает пожилых людей (редко младенцев, детей)
    • Субэпидермальные буллы
    • Предвестники экземы или крапивницы

    Герпетиформный дерматит

    • Ассоциированная глютен-чувствительная энтеропатия
    • Сильный зуд; везикулы часто удаляются расчесыванием, оставляя эрозии
    • Симметрично на голове, плечах, локтях, коленях, ягодицах

    Хроническое приобретенное образование пузырей

    Другие иммунобуллезные заболевания

    Поздняя кожная порфирия

    • Метаболическая фоточувствительность
    • Хрупкость кожи, буллы, милиумы
    • Тыльные стороны рук, лицо
    • Начало в среднем возрасте

    Другие иммунобуллезные болезни

     

    границ | Доставка лекарств на основе внеклеточных везикул эритроцитов: проблемы и возможности

    Введение

    Внеклеточные везикулы (ВВ) представляют собой везикулы клеточного происхождения, присутствующие в жидкостях организма, которые играют важную роль в межклеточной коммуникации между опухолевыми клетками и другими клетками в микро- и макроокружении опухоли (1).Эти секретируемые мембранные везикулы в настоящее время разделены на три основных класса на основе их размера и биогенеза следующим образом: (i) апоптотические тельца (диаметром 800–5000 нм), высвобождаемые клетками, подвергающимися запрограммированной гибели клеток; (ii) микровезикулы (МВ; 50–1000 нм в диаметре), которые представляют собой большие мембранные везикулы, образующиеся посредством отпочкования плазматической мембраны; и (iii) экзосомы (диаметром 40–100 нм), которые представляют собой небольшие везикулы, происходящие из эндосомального компартмента (2, 3). Было обнаружено, что большинство типов клеток естественным образом секретируют ВВ в нормальных, физиологических и патологических условиях из-за динамики клеточной мембраны (4).Более того, биологические функции электромобилей основаны на составе их поверхности и клеточном грузе, который обычно состоит из биоактивных молекул, таких как нуклеиновые кислоты, липиды и белки. Эти молекулы доставляются к соседним и отдаленным клеткам (5), и они приводят к изменениям судьбы и функции клеток-реципиентов и, следовательно, модулируют окружающее микроокружение. Электромобили опосредуют функции как в здоровом, так и в болезненном состоянии, поскольку они распространяют мини-сообщения по всему телу. Например, здоровые нестареющие мезенхимальные стволовые клетки могут высвобождать EV для восстановления поврежденных тканей и улучшения стволовости преждевременно стареющих стволовых клеток (6, 7).ЭВ, высвобождаемые из клеток болезненного состояния, содержат специфические молекулы, которые могут служить биомаркерами, а также могут действовать как медиаторы/усугубители патофизиологических процессов (8–11).

    EV могут быть выделены из различных клеток человека, включая раковые клетки, фибробласты, эпителиальные клетки, эндотелиальные клетки, иммунные клетки, тромбоциты и эритроциты (12). Эритроциты могут проходить через все типы сосудов и сжиматься в капилляры меньшего диаметра, чем нормальные эритроциты, для транспорта кислорода и обмена углекислого газа в клетках во всех тканях по всему телу.Внеклеточные везикулы, происходящие из эритроцитов (RBCEV), генерируются в кровообращении посредством отщепления плазматической мембраны, вызванного притоком кальция, опосредованным комплементом, с последующим отщеплением везикул (13). RBCEV участвуют в нескольких биологических процессах, таких как гомеостаз оксида азота (NO), окислительно-восстановительный баланс, иммуномодуляция и коагуляция (14). Поскольку они производятся из эритроцитов человека, в которых практически отсутствует как митохондриальная, так и ядерная ДНК, эритроцитарные гемоглобины имеют меньший риск горизонтального переноса генов.Эритроциты широко использовались для переливания крови в течение нескольких десятилетий, что подчеркивает потенциальную безопасность и биосовместимость RBCEV (15). Этот обзор посвящен RBCEV как надежным наноносителям с потенциальной полезностью в будущих стратегиях в качестве платформ доставки лекарств для клинических применений.

    Биогенез и производство RBCEV

    Нормальные эритроциты имеют гибкую двояковогнутую форму диаметром 7,5–8,7 мкм и толщиной 1,7–2,2 мкм (16). Фосфолипиды, включая фосфатидилхолин, фосфатидилэтаноламин, сфингомиелин и фосфатидилсерин, составляют 60% мембраны эритроцитов.Остальное содержимое состоит из липидных компартментов, состоящих из холестерина и гликолипидов, составляющих 30 и 10% мембраны соответственно (17). Кроме того, мембрана эритроцитов также содержит различные белки, такие как периферические белки (например, спектрины) и интегральные белки (например, полоса 3, гликофорины). Кроме того, мембранные белки эритроцитов можно разделить по функциям на три группы: белки цитоскелета (например, спектрин, актин, белок 4.1), интегральные структурные белки (например, полоса 3, гликофорины) и якорные белки (например, белок 4.1).г., анкирин, белок 4.2) (17). Хотя гемоглобины являются основными цитозольными белками интактных эритроцитов, цитоплазматическая фракция также содержит несколько белков, которые служат антиоксидантными и метаболическими ферментами (18, 19). Эти белки могут высвобождать аденозинтрифосфат (АТФ) и NO во внутриклеточную среду (20, 21). Кроме того, эритроциты также являются основными клетками, секретирующими везикулы, в кровообращении. В течение своей 120-дневной жизни эритроциты теряют примерно 20% содержания гемоглобина и целостности мембраны во время везикуляции.Физиологическое старение эритроцитов, особенно во второй половине их жизни, ускоряет образование везикул (22). Действительно, везикуляция является одним из наиболее важных механизмов, с помощью которых эритроциты удаляют любые опасные вещества, накопленные на протяжении всей их жизни, и предотвращают их раннее выведение из кровотока (23, 24).

    Мембранная везикуляция эритроцитов представляет собой гомеостатический процесс, активируемый в ответ на нарушенный или опасный сигнальный механизм (25). Этот специфический механизм образования пузырьков связан с физическим искажением мембраны эритроцитов, вызванным изменениями организации фосфолипидов (21).Везикуляция эритроцитов может быть вызвана истощением АТФ, нагрузкой кальцием, воздействием лизофосфатидной кислоты, разрушением мембранных белков при pH 5,4 или нагреванием, а также сшивкой с диамидом, что приводит к взаимодействиям между разрушенными мембранными белками/липидами и отщеплению мембраны эритроцитов с образованием обедненные спектрином МВ (26–30). Другие стимулы, вызывающие везикуляцию эритроцитов, включают окислительное повреждение, эндотоксин, цитокины, комплемент и высокое напряжение сдвига (31). Во время истощения АТФ активность насосов Ca 2+ плазматической мембраны снижается, что приводит к повышению концентрации Ca 2+ в эритроцитах (26).Поскольку ферменты плазматической мембраны, такие как флиппаза, флоппаза и скрамблаза, должны поддерживать асимметрию мембранных фосфолипидов, скрамблаза эритроцитов увеличивает воздействие анионных фосфолипидов на внешний листок плазматической мембраны (например, фосфатидилсерин) и затем высвобождает везикулы (32). Более того, циркулирующие эритроциты могут удалять мембранные атакующие компоненты сложных пор из плазматической мембраны в процессе, требующем Ca 2+ , активации кальпаина и разрушения спектрина посредством везикуляции, что приводит к образованию EV (33).Эта мембранная везикуляция может происходить медленно при старении эритроцитов, в кровотоке пациентов с гемолитическими нарушениями эритроцитов и в депонированных эритроцитах, полученных для переливания крови (34-36). Между тем, везикуляция эритроцитов также может возникать в ответ на истощение энергии и силу сжатия мембраны эритроцитов (30).

    Было применено несколько стимулов для воспроизводимой генерации RBCEV в качестве носителей лекарств, хотя остается неясным, могут ли различные типы стимулов приводить к различным свойствам RBCEV.Индуцирующие факторы, используемые для стимуляции эритроцитов к продукции RBCEV, представлены в таблице 1.

    Таблица 1 . Факторы, вызывающие продукцию RBCEV.

    RBCEV Состав

    RBCEV состоят из липидных бислойных сфероидов (почек) диаметром 100–200 нм, обогащенных фосфолипидами, белками, холестерином, липидными рафтами, гемоглобином и ацетилхолинэстеразой (37, 42). Компоненты RBCEV получены из эритроцитов; однако они не идентичны. По сравнению с их родительскими клетками в RBCEV отсутствуют молекулы, связанные с цитоскелетом, и они обладают более низким содержанием мембранных белков, но сохраняют остаточный гемоглобин и метаболические белки, которые способствуют их различным биологическим эффектам (25).Состав гемоглобинов, включая HbA1c, этих везикул аналогичен составу интактных эритроцитов (43). В таблице 2 обобщаются и сравниваются основные компоненты RBC и RBCEV.

    Таблица 2 . Сравнение основных компонентов эритроцитов и RBCEV.

    RBCEV содержат липидные рафты и Fas-ассоциированные белки для облегчения действия комплекса Fas-FADD-каспаза 8-каспаза 3 во время старения и гибели эритроцитов (51). Специфичные для стоматина липидные рафты, присутствующие на RBCEV, обогащены гликофосфатидилинозитол-заякоренными белками, т.е.например, фактор, ускоряющий распад комплемента (DAF или CD55), белок, ингибирующий комплекс, атакующий мембрану (CD59) (52, 53). RBCEV также экспрессируют CD47 на своей поверхности, чтобы ингибировать фагоцитоз посредством взаимодействия с белком, регулирующим сигналы рецепторов, ингибирующих макрофаги, альфа (SIRPα), тем самым предотвращая клиренс RBCEV посредством эндогенной элиминации (54). RBCEV также обогащены синексином и сорцином, двумя белками, связанными со специфическими для стоматина липидными рафтами, а также диацилглицерином и холестерином в качестве мембранных липидов (24, 44, 48).

    Примечательно, что компоненты RBCEV могут модифицироваться во время хранения эритроцитов (47, 55, 56). Предыдущие данные показали, что RBCEV, высвобождаемые из хранящихся единиц эритроцитов, с течением времени повышали экспрессию CD47 на поверхности и внутривезикулярные уровни miR-4454 и miR-451a (47, 56). Что касается мембранных липидов, RBCEV, высвобождаемые после 4 недель хранения эритроцитов, имели более высокие уровни церамидов, дигидроцерамидов, лизофосфатидилинозитола и лизофосфатидилглицерина, более низкие уровни фосфатидилинозитола и фосфатидилглицерина, но относительно неизменные уровни фосфатидилэтаноламина и лизофосфатидилэтаноламина (55).

    Заявки RBCEV на доставку лекарств

    Накопленные данные свидетельствуют о том, что RBCEV можно применять в системах доставки лекарств (15, 57). Краткая информация о производстве RRBCEV и грузовой упаковке для доставки лекарств показана на рисунке 1. RBCEV имеют несколько преимуществ по сравнению с обычными синтетическими транспортными средствами и электромобилями, не производными от эритроцитов, все из которых обсуждаются в этом разделе.

    Рисунок 1 . Производство РБКЭВ и грузовая упаковка для доставки лекарственных средств. Эритроциты продуцируют внеклеточные везикулы в ответ на увеличение внутриклеточных концентраций Ca 2+ .Молекулярный терапевтический груз (например, соединения, РНК, ДНК) может быть упакован в RBCEV посредством электропорации для доставки лекарственного средства. АТФ, аденозинтрифосфат; ПМА, форбол 12-миристат-13-ацетат; RBCEVs, внеклеточные везикулы, происходящие из эритроцитов; Эритроциты, эритроциты.

    RBCEV против синтетических нановезикул

    Желаемые свойства носителей лекарственных средств включают эффективное проникновение в клетки, близкие к естественным физико-химические свойства и способность уклоняться от иммунных реакций (58, 59).НВ получают из природных и синтетических везикулярных носителей. Типы естественных липидных NV включают экзосомы, виросомы, бактериальные призраки и эритроцитарные призраки (60). И наоборот, синтетические NV были созданы для имитации физико-химических свойств липосом (61). Липосомы содержат липидный бислой, окружающий водное ядро, что позволяет инкапсулировать и защищать гидрофильные молекулы, такие как микроРНК или ДНК (62).

    Липосомы широко используются для доставки лекарств, поскольку их структура может эффективно улавливать различные лекарства, а затем транспортировать груз к местам-мишеням (63).Этот подход продемонстрировал сильную терапевтическую эффективность при некоторых типах рака (64, 65). Однако липосомы обладают плохой селективностью в отношении раковых клеток, что приводит к серьезным системным побочным эффектам (66). Конъюгирование липосом со специфическими молекулами, такими как лиганды, антитела или малые молекулы, улучшает селективность и клеточное нацеливание (67–69). Имитируя свойства EV, синтетические NV, созданные из биомиметических двойных слоев фосфолипидов, приводят к нескольким улучшениям, таким как повышенная растворимость, пролонгированное действие, снижение токсичности и более низкие побочные эффекты (66, 70–72).Тем не менее, проблемы, ограничивающие применение синтетических НВ, — это иммунораспознавание чужеродных веществ и иммунный клиренс фагоцитарными клетками (73).

    В этом отношении RBCEV оказались чрезвычайно безопасными, и их можно использовать в качестве надежных носителей в клинических условиях из-за их биосовместимости (74). Что касается биобезопасности, биосовместимости, эффективности, доступности и экономической эффективности, RBCEV превосходят традиционные системы доставки РНК, такие как трехкомпонентные составы с РНК, катионными полимерами и инкапсулированными в анионные липосомы нейтральными липополиплексами (15, 75).Хотя традиционные системы доставки РНК, такие как липидные наночастицы, более стабильны, чем RBCEV, они вызывают токсические побочные эффекты и быстро выводятся из кровотока (76). RBCEV использовались в качестве носителей для терапевтических средств на основе РНК, чтобы облегчить эффективную доставку как коротких молекул РНК, так и длинных молекул мРНК к их целевым участкам для лечения рака (47). RBCEV, нагруженные молекулами РНК, демонстрируют долгосрочную стабильность и сохраняют свою функциональную способность в течение длительного времени (77).Более того, RBCEV обладают большим потенциалом в качестве платформ для доставки лекарств, поскольку они могут проникать через анатомические барьеры и демонстрировать достаточное связывание (78, 79). Эта выдающаяся платформа для доставки лекарств обладает особыми свойствами, которые делают ее пригодной для подходов к доставке лекарств (15). Дальнейшая разработка RBCEV, покрытых пептидами или антителами, направленными против рака, может привести к повышению специфичности мишени и уменьшению побочных эффектов в нормальных тканях. В дополнение к доставке терапевтических агентов, RBCEV могут применяться для доставки сверхмалых суперпарамагнитных частиц оксида железа в мезенхимальные стволовые клетки костного мозга человека для клеточной магнитно-резонансной томографии для повышения эффективности терапии стволовыми клетками (74).Кроме того, 99m Tc был доставлен в лейкоциты через RBCEV для наблюдения воспаления органов на мышиной модели с помощью гамма-камеры (80). Эта новая стратегия с использованием RBCEV в качестве средств доставки преодолевает ограничения традиционной визуализации, включая низкую эффективность внутриклеточного мечения и проблемы биобезопасности (74).

    Масштабирование производства, возможно, проще для синтетических NV. Однако следует отметить, что эритроциты можно легко приготовить по относительно низкой цене из единиц эритроцитов, имеющихся в банках крови.Химическая индукция (с использованием ионофоров кальция) для усиления высвобождения RBCEV является интересной стратегией масштабирования для крупномасштабной подготовки и клинического применения (22, 81). Более того, RBCEV сохраняют свою стабильность и эффективность доставки без каких-либо вредных эффектов даже после многократных циклов замораживания-оттаивания (82). Как упоминалось ранее, CD47, экспрессируемый на поверхности RBCEV, предотвращает фагоцитоз посредством взаимодействия с SIRPα (54), тем самым поддерживая стабильность RBCEV после внутривенного введения.Кроме того, ВВ могут эффективно проникать через гематоэнцефалический барьер (83). Сигнальные молекулы на мембране эритроцитов, которые являются компонентом RBCEV, могут ингибировать поглощение иммунными клетками посредством взаимодействия между CD47 и SIRPα и защищать от атаки системы комплемента посредством C8-связывающего белка, гомологичного рестрикционного белка, DAF, мембранного кофакторного белка , рецептор комплемента 1 и CD59 (84–86). Это свойство мембран эритроцитов было применено для покрытия наночастиц, чтобы увеличить их период полураспада в кровообращении для доставки лекарств (87).Примечательно, что можно приготовить аутологичные RBCEV для загрузки терапевтическим агентом (88).

    В совокупности RBCEV обладают преимуществами по сравнению с обычными носителями лекарств с точки зрения высокой биосовместимости с ограниченной иммуногенностью, простоты масштабирования и высокой стабильности (15). Тем не менее, есть некоторые недостатки RBCEV для доставки лекарств. Для RBCEV требуется надежный метод выделения, чтобы отделить их от клеток крови и загрязняющих белков. Гетерогенность популяций ЭВ, включая различия в размерах ЭВ в изолятах, почти неизбежна в зависимости от методов выделения.Систематическое сравнение методов выделения ЭВ по качеству и количеству ЭВ плазмы показало, что ультрацентрифугирование (золотой стандарт) является наиболее подходящим методом. Ультрацентрифугирование обеспечило лучшую чистоту EV по сравнению с ExoQuick (System Biosciences), полной изоляцией экзосом (TEI, Invitrogen), эксклюзионной хроматографией (qEV), ультрафильтрацией и exoEasy (Qiagen, мембранное аффинное связывание) (89). Однако наибольшая степень извлечения была достигнута при qEV (~60%), тогда как ультрацентрифугирование и ультрафильтрация дали степень извлечения ~40% (89).Преципитация на основе полимера содержала примесные частицы, в то время как набор exoEasy вызывал слияние и агрегацию ЭВ в процессе выделения (89). Микрожидкостные платформы и платформы для селекции антител, основанные на антиген-специфическом захвате, были успешно применены для выделения опухолеспецифических EV (90). К сожалению, микрожидкостная платформа может разделять ЭВ в относительно небольшом количестве, то есть 100 ЭВ на 1 мкл, и может вызывать агрегацию ЭВ в процессе выделения (90). Оптимизированный протокол подготовки RBCEV, включающий дополнительный этап контроля качества, необходим для сведения к минимуму эффектов партии и обеспечения воспроизводимости применений RBCEV.Примечательно, что не проводилось исследований для выяснения нормального диапазона концентрации EV в организме человека, и неясно, как различные распределения EV в здоровом или болезненном состоянии могут повлиять на эффективность терапии на основе RBCEV. Например, уровни EV, обогащенного нейронами, не изменились между здоровыми людьми и пациентами с болезнью Альцгеймера (91), поэтому дальнейшее изучение терапии RBCEV в контексте этого заболевания не связано с другим распределением EV. Лактоферрин человека может способствовать высвобождению EV из стволовых клеток, полученных из жировой ткани человека (92), поэтому заболевания с признаками изменений лактоферрина в плазме могут повлиять на интерпретацию терапевтической эффективности RBCEV.Взаимосвязь между (экзогенными) терапевтическими RBCEV и (эндогенным) распределением EV должна быть прояснена в будущих исследованиях.

    ЭРБКЭ по сравнению с ЭВ, не производными от эритроцитарной массы

    В настоящее время остается неясным, какие типы клеток являются лучшими источниками EV для доставки лекарств. Поскольку ЭВ несут мембранные лиганды и рецепторы своих родительских клеток, разные типы клеток могут продуцировать ЭВ с различной эффективностью доставки и избирательностью нацеливания (81). Сообщалось, что эритроциты, эндотелиальные клетки, моноциты, гранулоциты и тромбоциты являются источниками клеток для доставки лекарств на основе EV (93).И наоборот, EV, происходящие из фибробластов и дендритных клеток, стабильно не получаются у всех субъектов (94, 95), тогда как линии раковых клеток могут высвобождать EV, которые способствуют развитию опухоли (96, 97). Различные EV, происходящие из циркулирующих клеток, особенно полученные из ядерных клеток, могут содержать генетический материал, что приводит к горизонтальному переносу генов в клетки-реципиенты (98). Цельная плазма является основным источником ВВ, который легко получить и легко получить. Однако цельные ЭВ, полученные из плазмы, гетерогенны и могут содержать несколько (неизвестных) веществ (42).

    Экзосомы крови были сконструированы путем совместного встраивания лекарственного средства и модифицированного холестерином ингибитора миР-21 с высокой полезной нагрузкой в ​​липидный бислой экзосом (99). Кроме того, суперпарамагнитные молекулы и белки/пептиды-мишени были загружены в мембрану экзосом с использованием связывания лиганд-рецептор и электростатических взаимодействий для усиления доставки к опухолевым клеткам, а затем ингибирования роста опухоли (99, 100). Например, при лечении болезни Паркинсона инженерные экзосомы крови применяли к загруженному дофамину методом инкубации с насыщенным раствором в экзосомах, положительных по трансферриновым рецепторам крови, которые очищали с помощью множества суперпарамагнитных наночастиц, меченных трансферрином (101, 102).Кроме того, при лечении сахарного диабета 2 типа потенциальный терапевтический пептид BAY55-9837 был загружен в экзосому и соединен с суперпарамагнитными наночастицами оксида железа с активностью, нацеленной на островки поджелудочной железы, для увеличения секреции инсулина (103).

    Интересно, что некоторые свойства RBCEV позволяют им преодолевать ограничения других EV, полученных из клеточных источников. Во-первых, эритроциты легко получить и хранить в течение длительного времени после переливания крови. Во-вторых, RBCEV уже давно присутствуют в качестве скрытого компонента перелитых эритроцитов, что подчеркивает их безопасность и биосовместимость.В-третьих, RBCEV имеют низкий риск горизонтального переноса генов во время родов, поскольку в эритроцитах отсутствует ядерная и митохондриальная ДНК (44). Наконец, высвобождение RBCEV может быть вызвано несколькими процессами, такими как активация мембранного комплемента и приток кальция. Этот процесс высвобождения EV можно применять для производства большого количества RBCEV для экспериментального и клинического применения (81). Тем не менее, RBCEV следует рассматривать как продукт крови, и поэтому необходимо учитывать совместимость групп крови. В этом отношении аутологичные эритроциты могут быть идеальным источником EV, позволяющим избежать несовместимости групп крови или иммунного распознавания.

    Для аллогенного лечения больных раком RBCEV безопаснее, чем плазменные EV, потому что раковые и иммунные клетки обычно выделяют в кровоток чрезвычайно большое количество канцер-стимулирующих EV (96, 97).

    Сравнение характеристик доставки лекарств между эритроцитарными эритроцитами и неэритроцитарными EV представлено в таблице 3.

    Таблица 3 . Сравнение систем доставки лекарств между RBCEV и другими электромобилями.

    Лекарства и терапевтические молекулы, подходящие для транспорта, опосредованного RBCEV

    EV как естественные системы-носители эффективно доставляют сложные молекулы, включая белки, нуклеиновые кислоты, липиды и сахара, так же, как и их родительские клетки (109, 110).Более того, поскольку они обладают сходными мембранными свойствами, как и их родительские клетки, EVs могут легко интернализоваться в родительские клетки, а также в клетки-мишени посредством клатрин-независимого эндоцитоза и макропиноцитоза (109). Различные типы клеток могут использовать разные пути поглощения EV, такие как слияние мембран, фагоцитоз, микропиноцитоз и эндоцитоз (111). ЭВ могут связываться с поверхностными рецепторами клеток-мишеней, запускать внутриклеточные сигнальные каскады, а затем опосредовать поглощение ЭВ в зависимости от состава и происхождения ЭВ (112).Например, дендритные клетки, происходящие из моноцитов, могут поглощать EV , происходящие из молока, посредством специфичной для дендритных клеток молекулы межклеточной адгезии-3, захватывающей неинтегрин (DC-SIGN) и муцин1 (MUC1), взаимодействие белков и фагоцитоз, но не ЭВ, полученные из других источников или лишенные MUC1 (113). Кроме того, способность поглощения ЭВ зависит от типов клеток-реципиентов, но не от доноров (114). Например, поглощение EV клетками карциномы толстой кишки человека было опосредовано клатрин-зависимым эндоцитозом, но в клетках карциномы легких человека не было опосредовано ни клатрин-, ни кавеолин-зависимым эндоцитозом (114).Однако RBCEV могут проникать в раковые клетки через их первичные мембранные компоненты (например, фосфолипиды) (14, 115). Чтобы уменьшить потерю лекарств/молекул во время транспортировки к клеткам-мишеням, RBCEV предназначены для интернализации лекарств/молекул и достижения клеток-мишеней, не вызывая атаки иммунной системы и потери лекарств/молекул, что приводит к повышению эффективности лечения (116).

    Лекарства/малые молекулы легко загружаются в электромобили. Например, противовоспалительный агент куркумин загружали в экзосомы путем инкубации при 22°C в течение 5 минут (105).Нагруженные куркумином экзосомы были более стабильны, чем свободный куркумин in vivo после интраназального введения (105, 116). Кроме того, для загрузки миметика miR-15a использовали метод теплового шока для трансфекции бактериальных клеток (инкубация на льду в течение 30 мин с последующим выдерживанием при 42°C в течение 60 с) и пять раундов электропорации при 500 В с использованием 10-мс импульса. ингибитор в экзосомы (117, 118). Протокол загрузки EV должен быть оптимизирован для учета различий в свойствах различных источников EV (119).Размер ЭВ также может влиять на размер и количество загруженных лекарств/молекул (120). MV могут нести большее количество линейной и плазмидной ДНК, чем EV после электропорации (120). Кроме того, линейная дцДНК меньшего размера (<750 п.н.) была загружена в ЭВ (85 ± 41 нм) в больших количествах, чем более крупная дцДНК (>1000 п.н.) (120). Кроме того, загрузка miRNA в EV была оптимизирована путем инкубации при 22°C в течение 2 ч при pH 2,5 (121). Примечательно, что в отличие от методов загрузки миРНК в RBCEV, которые были всесторонне оценены и оптимизированы (15, 121), протоколы загрузки низкомолекулярных лекарств в RBCEV требуют дальнейших систематических исследований.

    Проблемы и ограничения приложений RBCEV

    Возможные побочные эффекты

    RBCEV могут иметь некоторые клеточные эффекты, поскольку они участвуют в нескольких биологических процессах, включая окислительный стресс, воспаление, гомеостаз NO, тромбоз и образование пенистых клеток (122). При окислительном стрессе RBCEV могут усиливать экспрессию НАДФН-оксидазы посредством избыточной продукции АФК активированными нейтрофилами посредством респираторного взрыва (123, 124). Это может изменить асимметрию цитоскелета и клеточных мембран, что приведет к образованию Oxi-ERY и гемолизу.В конечном итоге это может вызвать высвобождение холестерина, перекисное окисление липидов и агрегацию белков и железа, тем самым вызывая повреждение клеток сосудов (24, 125). Кроме того, во время воспаления компоненты мембраны RBCEV, включая холестерин (вызывает воспалительную реакцию), железо и миелопероксидазу (катализатор и источник продукции АФК соответственно), гемоглобин (активирует провоспалительный фактор транскрипции) и фосфолипазу А 2 (гидролизует фосфолипиды, что приводит к выработке медиаторов воспаления), может вызывать воспаление сосудов, приводящее к ишемической болезни сердца (21, 125–127).При гомеостазе NO RBCEV могут индуцировать NO-синтазу, что приводит к избыточной продукции NO, увеличению продукции ROS, усилению адгезии эритроцитов и усилению повреждения и дисфункции эндотелиальных клеток (128, 129). Во время тромбоза RBCEV обладают прокоагулянтной активностью, обеспечивая сайт (например, фосфатидилсерин) для сборки протромбиназы, чтобы ускорить коагуляционный каскад от протромбина до опосредованного тромбином образования сгустка (130). Когда состарившиеся или поврежденные эритроциты вступают в суицидальную гибель (эриптоз), клеточное сморщивание и вздутие и скремблирование клеточной мембраны приводят к воздействию фосфатидилсерина («съешь меня») на внешнюю поверхность клетки, а затем вызывают поглощение макрофагами, тем самым стимулируя образование пенистых клеток (24, 131, 132).Кроме того, холестерин на мембране эритроцитов может вызвать образование пенистых клеток (133). Однако эти вышеупомянутые причины повреждения сосудов могут возникать, когда кровеносные сосуды содержат большое количество RBCEV (134).

    Нагруженные лекарственными средствами RBCEV предназначены для значительного снижения побочных эффектов на нормальные клетки (135). Например, RBCEV, содержащие антисмысловые олигонуклеотиды миР-125b, эффективно противодействовали онкомиР и подавляли онкогенез без каких-либо наблюдаемых побочных эффектов при раке молочной железы (15).Кроме того, RBCEV индуцируют прокоагулянтную активность in vitro , но влияние на тромботические осложнения после переливания крови неизвестно (136).

    Конкретные сотовые цели

    В предыдущих исследованиях флуоресцентно меченные EV могли поглощаться и накапливаться клетками любого типа (137). Однако ЭВ содержат части плазматической мембраны в качестве родительских клеток, включая поверхностные лиганды и рецепторы. Этот факт подчеркивает, что EV имеют специфические взаимодействия с клетками-мишенями через несколько механизмов, таких как прямое слияние с плазматической мембраной, эндоцитоз, связывание с рецепторами клеточной поверхности и стыковка с клеточной поверхностью (111, 138, 139).Для этих механизмов необходимы взаимодействия между поверхностными белками EVs и белками клеток-реципиентов, такие как взаимодействия между синцитином и его главным облегчающим доменом надсемейства рецепторов 2a (140, 141).

    RBCEV, связанных с аминокислотной последовательностью-мишенью, могут доставлять лекарства к определенным раковым клеткам (135). Более того, инфицированные Plasmodium falciparum эритроциты, полученные из эритроцитов, нагруженные лекарствами, продемонстрировали лучшую терапевтическую эффективность против малярии in vitro , чем нормальные эритроциты, нагруженные лекарствами и без лекарств (142).Специфическое взаимодействие между ЭВ и клетками зависит от происхождения ЭВ и клеток-мишеней при активных процессах (115).

    Период полураспада и срок годности

    Факторы, влияющие на высвобождение RBCEV, включают (i) условия хранения эритроцитов (т. е. несколько недель при 4°C в аддитивных растворах), (ii) вариабельность доноров и (iii) метод лейкоредукции (89). Во-первых, в период эритроцитов концентрация АТФ внутри эритроцитов снижается, что приводит к дестабилизации скелета мембраны и увеличению внутриклеточного кальция, что приводит к везикуляции (143).Кроме того, потеря эндогенных антиоксидантов во время хранения эритроцитов вызывает окислительную деградацию ряда белков, таких как спектрин, бета-актин, глицеральдегид-3-фосфатдегидрогеназа и полоса 4.1, что приводит к процессам везикуляции (144, 145). Кроме того, в бета-цепи гемоглобина наблюдалась окислительная модификация, которая влияет на функцию гемоглобина (146). Точно так же хранение при 4°C может ингибировать АТФ-зависимую активность катионных насосов Na + /K + , что приводит к повышению концентрации Na + и Ca 2+ внутри клеток и, как следствие, к увеличению везикуляции эритроцитов (147). ).И наоборот, размер RBCEV изменяется при хранении от 100 нм через 5 дней до 200 нм через 42 дня (148). Во-вторых, донор-специфические факторы зависят от гематологического профиля, который влияет на базальное количество RBCEV и уровень гемолиза при приготовлении эритроцитарной массы. В-третьих, метод лейкоредукции влияет на размер и количество RBCEV, поскольку RBCEV, полученные путем фильтрации цельной крови , имели меньший диаметр (<200 нм) и более высокое общее количество, чем полученные с использованием метода лейкоцитарной пленки (149).

    Период полувыведения эритроцитов составляет 58 ± 1,5 дня (150), тогда как период полувыведения RBCEV из периферического кровообращения после инъекции с использованием 125 I-меченых RBCEV составляет 44 мин (83). Кроме того, RBCEV остаются стабильными и интактными даже после нескольких циклов замораживания-оттаивания и обладают долговременной стабильностью при температуре -80°C без влияния на фрагменты, поглощение и способность к загрузке генетического материала (135).

    Будущие перспективы и выводы

    Поскольку применение ЭВ не очевидно, Международное общество внеклеточных везикул стремилось стандартизировать и разработать рекомендации и руководящие принципы для улучшения воспроизводимости исследований ЭВ (151, 152).Электромобили могут доставлять небольшие молекулы, нуклеиновые кислоты, белки и наночастицы металлов для терапии и диагностики (153). Кроме того, miRNA внутри EV более стабильна, чем свободная miRNA, потому что она защищена от потенциально повреждающих агентов (154). Хотя системы доставки лекарств на основе EV имеют ограничения, включая отсутствие стандартных методов выделения и очистки, ограниченную эффективность загрузки лекарственного средства и недостаточное производство клинического уровня, EV имеют ряд преимуществ, таких как ограниченная иммуногенность и цитотоксичность, стабильность в циркуляции, и нацеливание на специфические клетки (153).Однако систематических исследований по определению нормального диапазона концентрации ЭВ в организме человека не проводилось, и это может стать важной темой исследований в будущем. Кроме того, несколько распространенных лекарств также могут влиять на распределение количества ЭВ в организме, например, индометацин (нестероидный противовоспалительный препарат для снятия боли), глибенкламид (препарат, снижающий уровень сахара в крови для лечения сахарного диабета), клопидогрел ( антитромбоцитарный препарат для предотвращения образования тромбов) может ингибировать биогенез и высвобождение EV (155).Эти препараты являются потенциальными искажающими факторами в клинических исследованиях ЭВ.

    Доставка лекарств на основе RBCEV исследовалась на нескольких моделях заболеваний (156). RBCEV можно использовать для доставки молекул РНК к клеточным мишеням и последующего высвобождения материала в клетки-реципиенты (156). RBCEV использовались в качестве средств доставки для генной терапии раковых клеток (26). RBCEV имеют несколько преимуществ, таких как отсутствие риска горизонтального переноса генов (отсутствие как митохондриальной, так и ядерной ДНК), исключительная биобезопасность и биосовместимость, простота хранения и транспортировки, а также простота крупномасштабного и рентабельного производства (157).

    Помимо доставки лекарств, RBCEV могут иметь и другие клинические применения, например, в качестве биомаркеров для диагностики. Человеческие RBCEV, несущие α-синуклеин, выделенный от пациентов с болезнью Паркинсона, могут преодолевать гематоэнцефалический барьер и нарушать поглощение глутамата через взаимодействие между транспортером возбуждающих аминокислот 2 и олигомерным α-синуклеином на концах астроцитов, что приводит к снижению уровня синаптофизина в полосатое тело в мышиной модели (158). Кроме того, повышенное количество RBCEV в кровообращении может указывать на гемолитические нарушения, такие как аутоиммунная гемолитическая анемия, комплемент-опосредованный гемолиз, малярия и наследственные нарушения мембран эритроцитов, в то время как пониженное количество наблюдалось при синдроме Скотта (аномалии клеточного кальция) (21, 159). –162).RBCEV, содержащие миРНК, являются потенциальными биомаркерами некоторых специфических заболеваний, таких как рак, малярия, серповидноклеточная анемия, рассеянный склероз и диабет (46). Более того, циркулирующие МВ, происходящие из эритроцитов, лейкоцитов, тромбоцитов или других органов и тканей, могут служить потенциальными биомаркерами для диагностики и терапевтического мониторинга в течение патогенеза кардиометаболических заболеваний и ишемической болезни сердца (163, 164). Более того, изучение терапевтической природы RBCEV может способствовать разработке методов лечения, сочетающих базовые эффекты RBCEV со специфическими интересующими лекарствами/функциональными молекулами.В этом направлении терапевтическая стратегия на основе RBCEV представлена ​​на рисунке 2. RBCEV могут быть получены из собственных эритроцитов (аутологичные) или эритроцитарной массы, соответствующей группе крови (аллогенные), и загружены терапевтическими агентами, т.е. молекулярные соединения, микроРНК или ДНК перед использованием. Нагруженные лекарствами RBCEV при полной совместимости с пациентами вводят в патологические ткани в органах-мишенях, где лекарственные препараты высвобождаются из EV для лечения заболеваний.

    Рисунок 2 .Предлагаемая стратегия лекарственной терапии RBCEV. Эритроциты могут быть собраны у одного пациента для получения аутологичных RBCEV и повторного введения после введения препарата тому же пациенту, когда это необходимо. В качестве альтернативы, RBCEV могут быть получены в больших масштабах из эритроцитарной массы, соответствующей группе крови, выпущенной из банка крови для аллогенной терапии RBCEV.

    Таким образом, RBCEV происходят из эритроцитов и содержат небольшое количество генетического материала и белков.Из-за своего небольшого размера и отсутствия горизонтального переноса генов RBCEV представляют собой хорошую систему доставки лекарств к клеточным мишеням с экономической эффективностью, неиммуногенностью, высокой стабильностью и биосовместимостью. Кроме того, RBCEV можно легко нацелить на каждый тип клеток, и они имеют короткую продолжительность жизни в организме. Таким образом, в будущем они могут стать выдающимися носителями систем доставки лекарств.

    Вклад авторов

    SC: концептуализация. WC и PN: написание — подготовка первоначального проекта.SH и SC: написание — обзор, редактирование и контроль. WC и SC: визуализация и получение финансирования. Все авторы внесли свой вклад в статью и одобрили представленную версию.

    Финансирование

    Это исследование было частично профинансировано Управлением по высшему образованию, науке, исследованиям и инновационной политике Таиланда (номер гранта B05F630082 для SC) и исследовательским грантом для новых исследователей Университета Махидол, Таиланд (номер гранта A11/2564 для WC) . Это исследование было проведено при поддержке медицинского факультета больницы Раматибоди Университета Махидол, Таиланд.SC также получил финансовую поддержку в рамках Программы развития профессорско-преподавательского состава больницы Раматибоди медицинского факультета Университета Махидол для его исследовательской деятельности. Спонсоры не участвовали в разработке исследования; при сборе, анализе или интерпретации данных; в написании рукописи или в решении опубликовать результаты.

    Конфликт интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

    Примечание издателя

    Все претензии, изложенные в этой статье, принадлежат исключительно авторам и не обязательно представляют претензии их дочерних организаций или издателя, редакторов и рецензентов. Любой продукт, который может быть оценен в этой статье, или претензии, которые могут быть сделаны его производителем, не гарантируются и не поддерживаются издателем.

    Благодарности

    Рисунок создан с помощью BioRender.com. Мы благодарим Джо Барбера-младшего., PhD, из Edanz (https://www.edanz.com/ac) за редактирование черновика этой рукописи.

    Ссылки

    3. Crescitelli R, Lasser C, Szabo TG, Kittel A, Eldh M, Dianzani I, et al. Различные профили РНК в субпопуляциях внеклеточных везикул: апоптотических тельцах, микровезикулах и экзосомах. J Внеклеточные везикулы. (2013) 2:20677. дои: 10.3402/jev.v2i0.20677

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    4. Walker S, Busatto S, Pham A, Tian M, Suh A, Carson K, et al.Системы доставки лекарств на основе внеклеточных везикул для лечения рака. Тераностика. (2019) 9:8001–17. doi: 10.7150/thno.37097

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    5. Гурунатан С., Кан М.Х., Джеярадж М., Касим М., Ким Дж.Х. Обзор выделения, характеристики, биологической функции и разнообразных терапевтических подходов экзосом. Клетки. (2019) 8:307. doi: 10.3390/cells8040307

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    6.Мас-Барг С., Санс-Рос Дж., Роман-Домингес А., Химено-Малленч Л., Инглес М., Вина Дж. и др. Внеклеточные везикулы из здоровых клеток улучшают клеточную функцию и стволовость в преждевременно стареющих стволовых клетках за счет активации miR-302b и HIF-1alpha. Биомолекулы. (2020) 10:957. doi: 10.3390/biom10060957

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    7. Whitham M, Parker BL, Friedrichsen M, Hingst JR, Hjorth M, Hughes WE, et al. Внеклеточные везикулы обеспечивают взаимодействие тканей во время упражнений. Сотовый метаб. (2018) 27:237–51.e4. doi: 10.1016/j.cmet.2017.12.001

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    8. Chen IH, Xue L, Hsu CC, Paez JS, Pan L, Andaluz H, et al. Фосфопротеины внеклеточных везикул как маркеры-кандидаты на рак молочной железы. Proc Natl Acad Sci USA. (2017) 114:3175–80. doi: 10.1073/pnas.1618088114

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    9. Joncas FH, Lucien F, Rouleau M, Morin F, Leong HS, Pouliot F, et al.Плазменные внеклеточные везикулы как фенотипические биомаркеры у больных раком предстательной железы. Простата. (2019) 79:1767–76. дои: 10.1002/прос.23901

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    11. Мураока С., ДеЛео А.М., Сети М.К., Юкава-Такамацу К., Ян З., Ко Дж. и др. Протеомное и биологическое профилирование внеклеточных везикул из тканей головного мозга человека с болезнью Альцгеймера. Болезнь Альцгеймера. (2020) 16: 896–907. doi: 10.1002/alz.12089

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    13.Wannez A, Devalet B, Chatelain B, Chatelain C, Dogne JM, Mullier F. Внеклеточные везикулы в концентратах эритроцитов: обзор. Transfus Med Rev. (2019) 33:125–30. doi: 10.1016/j.tmrv.2019.02.002

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    14. Тангараджу К., Нируконда С.Н., Катнени У., Бюлер П.В. Внеклеточные везикулы из эритроцитов и их развивающаяся роль в здоровье, коагулопатии и терапии. Int J Mol Sci. (2020) 22:153.дои: 10.3390/ijms22010153

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    15. Usman WM, Pham TC, Kwok YY, Vu LT, Ma V, Peng B, et al. Эффективная доставка РНК-препаратов с использованием внеклеточных везикул эритроцитов. Нац.коммун. (2018) 9:2359. doi: 10.1038/s41467-018-04791-8

    Реферат PubMed | Полный текст перекрестной ссылки

    16. Диез-Сильва М., Дао М., Хан Дж., Лим С.Т., Суреш С. Форма и биомеханические характеристики эритроцитов человека в норме и при патологии. МИССИС Бык. (2010) 35:382–8. doi: 10.1557/mrs2010.571

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    19. Кахниашвили Д.Г., Булла Л.А. мл., Гудман С.Р. Протеом эритроцитов человека: анализ методом масс-спектрометрии с ионной ловушкой. Мол клеточная протеомика. (2004) 3:501–9. doi: 10.1074/mcp.M300132-MCP200

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    20. Donadee C, Raat NJ, Kanias T, Tejero J, Lee JS, Kelley EE, et al.Удаление оксида азота микрочастицами эритроцитов и бесклеточным гемоглобином как механизм повреждения эритроцитов. Тираж. (2011) 124:465–76. doi: 10.1161/РАСПИСАНИЕAHA.110.008698

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    22. Antonelou MH, Seghatchian J. Новые данные о внеклеточных везикулах внутри единиц хранения эритроцитов: отрегулируйте паруса ближе к новому ветру. Transfus Apher Sci. (2016) 55:92–104. дои: 10.1016/j.transci.2016.07.016

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    23. Bosman GJ, Lasonder E, Luten M, Roerdinkholder-Stoelwinder B, Novotny VM, Bos H, et al. Протеом мембран и везикул эритроцитов при хранении в условиях банка крови. Переливание. (2008) 48:827–35. doi: 10.1111/j.1537-2995.2007.01630.x-i2

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    24. Willekens FL, Werre JM, Groenen-Dopp YA, Roerdinkholder-Stoelwinder B, de Pauw B, Bosman GJ.Везикуляция эритроцитов: механизм самозащиты? Бр Ж Гематол. (2008) 141:549–56. doi: 10.1111/j.1365-2141.2008.07055.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    27. Kabaso D, Shlomovitz R, Auth T, Lew VL, Gov NS. Скручивание и локальные изменения формы мембран эритроцитов, вызванные реорганизацией цитоскелета. Biophys J. (2010) 99:808–16. doi: 10.1016/j.bpj.2010.04.067

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    28.Джаферзаде К., Сим М., Ким Н., Мун И. Количественный анализ трехмерной морфологии и динамики мембран эритроцитов при повышении температуры. Научный доклад (2019) 9:14062. doi: 10.1038/s41598-019-50640-z

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    29. Панталео А., Ферру Э., Гирибальди Г., Манну Ф., Карта Ф., Матте А. и др. Окисленная и плохо гликозилированная полоса 3 селективно фосфорилируется киназой Syk с образованием больших мембранных кластеров в нормальных и дефицитных по G6PD эритроцитах. Biochem J. (2009) 418:359–67. дои: 10.1042/BJ20081557

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    30. Salzer U, Zhu R, Luten M, Isobe H, Pastushenko V, Perkmann T, et al. Везикулы, образующиеся при хранении эритроцитов, богаты маркером липидного рафта стоматином. Переливание. (2008) 48:451–62. doi: 10.1111/j.1537-2995.2007.01549.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    32. Nguyen DB, Wagner-Britz L, Maia S, Steffen P, Wagner C, Kaestner L, et al.Регуляция экспозиции фосфатидилсерина в эритроцитах. Cell Physiol Biochem. (2011) 28:847–56. дои: 10.1159/000335798

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    33. Iida K, Whitlow MB, Nussenzweig V. Мембранная везикуляция защищает эритроциты от разрушения комплементом. Дж Иммунол. (1991) 147:2638–42.

    Реферат PubMed | Академия Google

    34. Asaro RJ, Zhu Q, Cabrales P. Старение эритроцитов, защита посредством везикуляции: методология анализа с помощью колебательного потока. Фронт Физиол. (2018) 9:1607. doi: 10.3389/fphys.2018.01607

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    35. Huisjes R, Bogdanova A, van Solinge WW, Schiffelers RM, Kaestner L, van Wijk R. Сжатие на всю жизнь — свойства деформируемости эритроцитов. Фронт Физиол. (2018) 9:656. doi: 10.3389/fphys.2018.00656

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    36. Лорен Э., Тигисту-Сахле Ф., Валконен С., Вестберг М., Валкеаярви А., Эронен Дж. и соавт.Фосфолипидный состав эритроцитарной массы и внеклеточных везикул демонстрирует высокое сходство и стабильность при хранении. Biochim Biophys Acta Mol Cell Bio Lipids. (2018) 1863:1–8. doi: 10.1016/j.bbalip.2017.09.012

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    37. Nguyen DB, Ly TB, Wesseling MC, Hittinger M, Torge A, Devitt A, et al. Характеристика микровезикул, высвобождаемых из эритроцитов человека. Cell Physiol Biochem. (2016) 38:1085–99. дои: 10.1159/000443059

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    39. Судницына Ю., Скверчинская Е., Добрылко И., Никитина Е., Гамбарян С., Миндукшев И. Образование микровезикул, индуцированное окислительным стрессом в эритроцитах человека. Антиоксиданты. (2020) 9:929. doi: 10.3390/antiox

    29

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    41. Прудент М., Креттаз Д., Делобель Дж., Сегачян Дж., Тиссо Д.Д., Лайон Н.Различия между микровезикулами, происходящими из эритроцитов, стимулированными кальцием и индуцированными накоплением. Transfus Apher Sci. (2015) 53:153–8. doi: 10.1016/j.transci.2015.10.012

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    42. Arraud N, Linares R, Tan S, Gounou C, Pasquet JM, Mornet S, et al. Внеклеточные везикулы из плазмы крови: определение их морфологии, размера, фенотипа и концентрации. Дж Тромб Гемост. (2014) 12:614–27. дои: 10.1111/jth.12554

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    43. Bosman GJ, Werre JM, Willekens FL, Novotny VM. Старение эритроцитов in vivo и in vitro: структурные аспекты и последствия для переливания крови. Трансфус Мед. (2008) 18:335–47. doi: 10.1111/j.1365-3148.2008.00892.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    45. Shi J, Kundrat L, Pishesha N, Bilate A, Theile C, Maruyama T, et al. Сконструированные эритроциты в качестве носителей для системной доставки широкого спектра функциональных зондов. Proc Natl Acad Sci USA. (2014) 111:10131–6. doi: 10.1073/pnas.1409861111

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    47. Huang H, Zhu J, Fan L, Lin Q, Fu D, Wei B, et al. Профилирование микроРНК экзосом, полученных из единиц эритроцитов: значение в иммуномодуляции, связанной с переливанием крови. Биомед Рез Инт. (2019) 2019:2045915. дои: 10.1155/2019/2045915

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    48.Salzer U, Hinterdorfer P, Hunger U, Borken C, Prohaska R. Ca(++)-зависимое высвобождение пузырьков из эритроцитов включает стоматин-специфические липидные рафты, синексин (аннексин VII) и сорцин. Кровь. (2002) 99:2569–77. doi: 10.1182/кровь.V99.7.2569

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    49. Kleinbongard P, Schulz R, Rassaf T, Lauer T, Dejam A, Jax T, et al. Эритроциты экспрессируют функциональную эндотелиальную синтазу оксида азота. Кровь. (2006) 107:2943–51.doi: 10.1182/blood-2005-10-3992

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    51. Крибардис А.Г., Антонелоу М.Х., Стамулис К.Е., Эконому-Петерсен Э., Маргаритис Л.Х., Папассидери И.С. Везикулы, полученные из эритроцитов, при хранении: ультраструктура, белковый состав, окисление и сигнальные компоненты. Переливание. (2008) 48:1943–53. doi: 10.1111/j.1537-2995.2008.01794.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    52.Клейтон А., Харрис С.Л., Корт Дж., Мейсон М.Д., Морган Б.П. Экзосомы антигенпрезентирующих клеток защищены от комплемент-опосредованного лизиса за счет экспрессии CD55 и CD59. Евро J Иммунол. (2003) 33:522–31. doi: 10.1002/immu.200310028

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    53. Rabesandratana H, Toutant JP, Reggio H, Vidal M. Фактор ускорения распада (CD55) и мембранный ингибитор реактивного лизиса (CD59) высвобождаются в экзосомах во время in vitro созревания ретикулоцитов. Кровь. (1998) 91:2573–80. doi: 10.1182/кровь.V91.7.2573

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    54. Burger P, Hilarius-Stokman P, de Korte D, van den Berg TK, van Bruggen R. CD47 функционирует как молекулярный переключатель для фагоцитоза эритроцитов. Кровь. (2012) 119:5512–21. doi: 10.1182/blood-2011-10-386805

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    55. Cloos AS, Ghodsi M, Stommen A, Vanderroost J, Dauguet N, Pollet H, et al.Взаимодействие между изменением липидов плазматической мембраны, окислительным стрессом и основанным на кальции механизмом биогенеза внеклеточных везикул из эритроцитов во время хранения крови. Фронт Физиол. (2020) 11:712. doi: 10.3389/fphys.2020.00712

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    56. Gamonet C, Desmarets M, Mourey G, Biichle S, Aupet S, Laheurte C, et al. Методы обработки и продолжительность хранения влияют на количество внеклеточных везикул в единицах эритроцитов. Кровь Adv. (2020) 4:5527–39. doi: 10.1182/bloodadvances.2020001658

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    57. Zhang G, Huang X, Xiu H, Sun Y, Chen J, Cheng G, et al. Внеклеточные везикулы: естественные накапливающиеся в печени средства доставки лекарств для лечения заболеваний печени. J Внеклеточные везикулы. (2020) 10:e12030. doi: 10.1002/jev2.12030

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    58.Фернандеш М., Лопес И., Тейшейра Х., Ботелью К., Гомеш А.С. Экзосомоподобные наночастицы: новый тип наноносителя. Curr Med Chem. (2020) 27:3888–905. дои: 10.2174/09298673266661142604

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    59. Zhang P, Zhang L, Qin Z, Hua S, Guo Z, Chu C, et al. Генетически сконструированные липосомоподобные нановезикулы в качестве активной таргетной транспортной платформы. Adv Mater. (2018) 30:1705350. doi: 10.1002/adma.201705350

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    61.Ройес Дж., Илиоая О., Любарт К., Ангиус Ф., Дубачева Г.В., Балли М. и соавт. Производство на основе бактерий тиол-кликабельных, генетически кодируемых липидных нановезикул. Angew Chem Int Ed Engl. (2019) 58:7395–9. doi: 10.1002/anie.201

    9

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    62. Солтани Ф., Пархиз Х., Мохтарзаде А., Рамезани М. Синтетические и биологические везикулярные наноносители, предназначенные для доставки генов. Курр Фарм Дез. (2015) 21:6214–35.дои: 10.2174/1381612821666151027153410

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    64. An D, Yu X, Jiang L, Wang R, He P, Chen N, et al. Реверсирование множественной лекарственной устойчивости липосомами доксорубицина, модифицированными аполипопротеином А1, для лечения рака молочной железы. молекулы. (2021) 26:1280. doi: 10.3390/молекулы26051280

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    65. Пиньо Ж.О., да Силва И.В., Амарал Ж.Д., Родригес С.М.П., ​​Касини А., Соверал Г. и соавт.Терапевтический потенциал медного комплекса, загруженного в рН-чувствительные длинноциркулирующие липосомы, для лечения рака толстой кишки. Int J Фарм. (2021) 599:120463. doi: 10.1016/j.ijpharm.2021.120463

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    67. Леунг К. Сиалил-Льюис(х)-липосома-Cy5.5. База данных молекулярных изображений и контрастных веществ (MICAD) . Bethesda, MD: Национальный центр биотехнологической информации (2004 г.).

    Реферат PubMed | Академия Google

    68.Dasa SSK, Suzuki R, Gutknecht M, Brinton LT, Tian Y, Michaelsson E, et al. Разработка таргет-специфических липосом для доставки низкомолекулярных препаратов после реперфузионного инфаркта миокарда. J Разблокировка управления. (2015) 220:556–67. doi: 10.1016/j.jconrel.2015.06.017

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    69. Пури А., Крамер-Марек Г., Кэмпбелл-Масса Р., Явлович А., Теле С.К., Ли С.Б. и соавт. HER2-специфические термочувствительные липосомы (афизомы), конъюгированные с аффителом, для улучшенной доставки противоопухолевых агентов. J Липосомный рез. (2008) 18: 293–307. дои: 10.1080/08982100802457377

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    70. Сакаи-Като К., Ёсида К., Такечи-Харая Ю., Изуцу К.И. Физико-химическая характеристика липосом, имитирующих липидный состав экзосом для эффективного внутриклеточного переноса. Ленгмюр. (2020) 36:12735–44. doi: 10.1021/acs.langmuir.0c02491

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    71.Коойманс С.А., Вейдер П., ван Доммелен С.М., ван Солиндж В.В., Шиффелерс Р.М. Экзосомные миметики: новый класс систем доставки лекарств. Int J Nanomed. (2012) 7:1525–41. doi: 10.2147/IJN.S29661

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    72. Васкес-Риос А.Дж., Молина-Креспо А., Бузо Б.Л., Лопес-Лопес Р., Морено-Буэно Г., де ла Фуэнте М. Наноплатформы-миметики экзосом для адресной доставки лекарств от рака. Дж Нанобиотехнологии. (2019) 17:85. дои: 10.1186/с12951-019-0517-8

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    73. Лай Р.К., Йео Р.В., Тан К.Х., Лим С.К. Экзосомы для доставки лекарств — новое применение мезенхимальных стволовых клеток. Биотехнология Adv. (2013) 31:543–51. doi: 10.1016/j.biotechadv.2012.08.008

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    74. Chang M, Hsiao JK, Yao M, Chien LY, Hsu SC, Ko BS, et al. Гомологичные везикулы, полученные из эритроцитов, как сверхмалые носители оксида железа для магнитно-резонансной томографии стволовых клеток. Нанотехнологии. (2010) 21:235103. дои: 10.1088/0957-4484/21/23/235103

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    75. Perche F, Clemencon R, Schulze K, Ebensen T, Guzman CA, Pichon C. Нейтральные липополиплексы для доставки in vivo обычной и репликативной РНК-вакцины. Мол Тер Нуклеиновые Кислоты. (2019) 17:767–75. doi: 10.1016/j.omtn.2019.07.014

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    77.Koopaei NN, Chowdhury EA, Jiang J, Noorani B, da Silva L, Bulut G, et al. Обогащение эритроцитарной миР-451a во внеклеточных везикулах головного мозга после нарушения гематоэнцефалического барьера. Neurosci Lett. (2021) 751:135829. doi: 10.1016/j.neulet.2021.135829

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    78. Mantel PY, Hjelmqvist D, Walch M, Kharoubi-Hess S, Nilsson S, Ravel D, et al. Инфицированные внеклеточные везикулы, происходящие из эритроцитов, изменяют функцию сосудов посредством регуляторных комплексов Ago2-миРНК при малярии. Нац.коммун. (2016) 7:12727. doi: 10.1038/ncomms12727

    Реферат PubMed | Полный текст перекрестной ссылки

    79. Oliveira GP Jr, Zigon E, Rogers G, Davodian D, Lu S, et al. Обнаружение внеклеточной везикулярной РНК с использованием молекулярных маяков. iScience. (2020) 23:100782. doi: 10.1016/j.isci.2019.100782

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    80. Son SH, Oh JM, Gangadaran P, Ji HD, Lee HW, Rajendran RL, et al. Мечение лейкоцитов технецием-99m ((99m)Tc) с использованием внеклеточных везикул-миметиков эритроцитов. Клетки крови Mol Dis. (2020) 80:102375. doi: 10.1016/j.bcmd.2019.102375

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    83. Matsumoto J, Stewart T, Sheng L, Li N, Bullock K, Song N, et al. Передача альфа-синуклеинсодержащих внеклеточных везикул эритроцитарного происхождения через гематоэнцефалический барьер посредством трансцитоза, опосредованного адсорбцией: еще один механизм инициации и прогрессирования болезни Паркинсона? Acta Neuropathol Commun. (2017) 5:71. doi: 10.1186/s40478-017-0470-4

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    84. Барклай А.Н., Ван ден Берг Т.К. Взаимодействие между сигнальным регуляторным белком альфа (SIRPalpha) и CD47: структура, функция и терапевтическая мишень. Annu Rev Immunol. (2014) 32:25–50. doi: 10.1146/annurev-immunol-032713-120142

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    85. Schonermark S, Rauterberg EW, Shin ML, Loke S, Roelcke D, Hansch GM.Ограничение гомологичных видов при лизисе эритроцитов человека: белок мембранного происхождения со способностью связывать С8 действует как ингибитор. Дж Иммунол. (1986) 136:1772–6.

    Резюме PubMed

    86. Залман Л.С., Вуд Л.М., Мюллер-Эберхард Х.Дж. Выделение белка мембраны эритроцитов человека, способного ингибировать экспрессию гомологичных трансмембранных каналов комплемента. Proc Natl Acad Sci USA. (1986) 83:6975–9. doi: 10.1073/pnas.83.18.6975

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    87.Xia Q, Zhang Y, Li Z, Hou X, Feng N. Наночастицы, замаскированные мембраной эритроцита: новая система доставки лекарств для противоопухолевого применения. Acta Pharm Sin B. (2019) 9:675–89. doi: 10.1016/j.apsb.2019.01.011

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    88. Назимек К., Бустос-Моран Э., Блас-Рус Н., Новак Б., Птак В., Аскеназе П.В. и соавт. Сингенные внеклеточные везикулы, индуцированные эритроцитами, подавляют гиперчувствительность замедленного типа к собственным антигенам у мышей. Clin Exp Аллергия. (2019) 49:1487–99. doi: 10.1111/cea.13475

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    89. Tian Y, Gong M, Hu Y, Liu H, Zhang W, Zhang M, et al. Оценка качества и эффективности шести методов выделения внеклеточных везикул с помощью нанопроточной цитометрии. J Внеклеточные везикулы. (2020) 9:1697028. дои: 10.1080/20013078.2019.1697028

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    90. Reategui E, van der Vos KE, Lai CP, Zeinali M, Atai NA, Aldikacti B, et al.Разработаны наноинтерфейсы для микрожидкостной изоляции и молекулярного профилирования опухолеспецифических внеклеточных везикул. Нац.коммун. (2018) 9:175. doi: 10.1038/s41467-017-02261-1

    Реферат PubMed | Полный текст перекрестной ссылки

    91. Kapogiannis D, Mustapic M, Shardell MD, Berkowitz ST, Diehl TC, Spangler RD, et al. Ассоциация биомаркеров внеклеточных везикул с болезнью Альцгеймера в лонгитюдном исследовании старения в Балтиморе. JAMA Нейрол. (2019) 76:1340–51.doi: 10.1001/jamaneurol.2019.2462

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    92. Kim J, You GE, Woo M, Chang NH, Lee J. Открытие лактоферрина в качестве стимулятора секреции EV, полученного из hADSC, и доказательство усиления полученных EV на модели кожи. Int J Mol Sci. (2021) 22:10993. дои: 10.3390/ijms222010993

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    93. Чаттерджи В., Ян Х., Ма Ю., Ву М.Х., Юань С.Ю.Внеклеточные везикулы: новые игроки в регуляции функции сосудистого барьера. Am J Physiol Heart Circ Physiol. (2020) 319:h2181–H96. doi: 10.1152/ajpheart.00579.2020

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    94. Альварес-Эрвити Л., Сеоу Ю., Инь Х., Беттс С., Лахал С., Вуд М.Дж. Доставка siRNA в мозг мыши путем системной инъекции экзосом-мишеней. Нац биотехнолог. (2011) 29:341–5. doi: 10.1038/nbt.1807

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    95.Камеркар С., ЛеБлё В.С., Сугимото Х., Ян С., Руиво С.Ф., Мело С.А. и др. Экзосомы облегчают терапевтическое нацеливание на онкогенный KRAS при раке поджелудочной железы. Природа. (2017) 546:498–503. doi: 10.1038/nature22341

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    98. Wahlgren J, De LKT, Brisslert M, Vaziri Sani F, Telemo E, Sunnerhagen P, et al. Плазменные экзосомы могут доставлять экзогенную короткую интерферирующую РНК к моноцитам и лимфоцитам. Рез. нуклеиновых кислот. (2012) 40:e130. doi: 10.1093/nar/gks463

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    99. Zhan Q, Yi K, Qi H, Li S, Li X, Wang Q, et al. Разработка экзосом крови для эффективной комбинированной генной/химиотерапии, нацеленной на опухоль. Тераностика. (2020) 10:7889–905. doi: 10.7150/thno.45028

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    100. Qi H, Liu C, Long L, Ren Y, Zhang S, Chang X, et al. Экзосомы крови, наделенные магнитными и нацеливающими свойствами, для терапии рака. АКС Нано. (2016) 10:3323–33. doi: 10.1021/acsnano.5b06939

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    101. Qu M, Lin Q, Huang L, Fu Y, Wang L, He S, et al. Нагруженные дофамином экзосомы крови нацелены на мозг для лучшего лечения болезни Паркинсона. J Разблокировка управления. (2018) 287:156–66. doi: 10.1016/j.jconrel.2018.08.035

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    102. Yang L, Han D, Zhan Q, Li X, Shan P, Hu Y, et al.Экзосомы TfR+ крови, выделенные pH-зависимым методом, доставляют химиотерапевтические средства для терапии опухолей. Тераностика. (2019) 9:7680–96. doi: 10.7150/thno.37220

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    103. Zhuang M, Du D, Pu L, Song H, Deng M, Long Q, et al. Экзосома, украшенная SPION, доставила BAY55-9837, нацеленную на поджелудочную железу посредством магнетизма, чтобы улучшить реакцию GLC крови. Маленький. (2019) 15:e1

    5. doi: 10.1002/smll.201

    5

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    104.Хейни М.Дж., Клячко Н.Л., Чжао Ю., Гупта Р., Плотникова Е.Г., Хе З. и др. Экзосомы как средства доставки лекарств для лечения болезни Паркинсона. J Разблокировка управления. (2015) 207:18–30. doi: 10.1016/j.jconrel.2015.03.033

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    105. Sun D, ​​Zhuang X, Xiang X, Liu Y, Zhang S, Liu C, et al. Новая система доставки лекарств в виде наночастиц: противовоспалительная активность куркумина усиливается при инкапсулировании в экзосомы. мол. тер. (2010) 18:1606–14. doi: 10.1038/mt.2010.105

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    106. Saari H, Lazaro-Ibanez E, Viitala T, Vuorimaa-Laukkanen E, Siljander P, Yliperttula M. Доставка лекарств, опосредованная микровезикулами и экзосомами, повышает цитотоксичность паклитаксела в аутологичных клетках рака предстательной железы. J Разблокировка управления. (2015) 220:727–37. doi: 10.1016/j.jconrel.2015.09.031

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    107.Чжан Ю.Ф., Ши Дж.Б., Ли С. Системы загрузки малых внеклеточных везикул в терапии рака: текущее состояние и путь вперед. Цитотерапия. (2019) 21:1122–36. doi: 10.1016/j.jcyt.2019.10.002

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    108. Balaj L, Lessard R, Dai L, Cho YJ, Pomeroy SL, Breakefield XO, et al. Опухолевые микровезикулы содержат элементы ретротранспозонов и амплифицированные последовательности онкогенов. Нац.коммун. (2011) 2:180. doi: 10.1038/ncomms1180

    Реферат PubMed | Полный текст перекрестной ссылки

    109.Costa Verdera H, Gitz-Francois JJ, Schiffelers RM, Vader P. Клеточное поглощение внеклеточных везикул опосредуется клатрин-независимым эндоцитозом и макропиноцитозом. J Разблокировка управления. (2017) 266:100–8. doi: 10.1016/j.jconrel.2017.09.019

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    110. Yanez-Mo M, Siljander PR, Andreu Z, Zavec AB, Borras FE, Buzas EI, et al. Биологические свойства внеклеточных везикул и их физиологические функции. J Внеклеточные везикулы. (2015) 4:27066. doi: 10.3402/jev.v4.27066

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    112. Торибио В., Моралес С., Лопес-Мартин С., Карденес Б., Кабанас С., Янез-Мо М. Разработка количественного метода измерения поглощения EV. Научный доклад (2019) 9:10522. doi: 10.1038/s41598-019-47023-9

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    113. Naslund TI, Paquin-Proulx D, Paredes PT, Vallhov H, Sandberg JK, Gabrielsson S.Экзосомы грудного молока ингибируют инфицирование дендритных клеток ВИЧ-1 и последующий перенос вируса на CD4+ Т-клетки. СПИД. (2014) 28:171–80. doi: 10.1097/QAD.0000000000000159

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    114. Horibe S, Tanahashi T, Kawauchi S, Murakami Y, Rikitake Y. Механизм зависимых от клеток-реципиентов различий в поглощении экзосом. Рак BMC. (2018) 18:47. doi: 10.1186/s12885-017-3958-1

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    115.Копонен А., Керкела Э., Рохалин Т., Ласаро-Ибанес Э., Суутари Т., Саари Х.О. и др. Безмаркерная характеристика и мониторинг в реальном времени поглощения клетками внеклеточных везикул. Биосенс ​​Биоэлектрон. (2020) 168:112510. doi: 10.1016/j.bios.2020.112510

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    116. Zhuang X, Xiang X, Grizzle W, Sun D, ​​Zhang S, Axtell RC, et al. Лечение воспалительных заболеваний головного мозга путем доставки противовоспалительных препаратов, инкапсулированных экзосомами, из области носа в головной мозг. мол. тер. (2011) 19:1769–79. doi: 10.1038/mt.2011.164

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    117. Zhang D, Lee H, Zhu Z, Minhas JK, Jin Y. Обогащение селективных миРНК в экзосомах и доставка экзосомальных миРНК in vitro и in vivo. Am J Physiol Lung Cell Mol Physiol. (2017) 312:L110–L21. doi: 10.1152/ajplung.00423.2016

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    118. Чжан Д., Ли Х., Джин Ю.Доставка функциональных малых РНК через внеклеточные везикулы in vitro и in vivo . Методы Mol Biol. (2020) 2115:107–17. дои: 10.1007/978-1-0716-0290-4_6

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    119. Pomatto MAC, Bussolati B, D’Antico S, Ghiotto S, Tetta C, Brizzi MF, et al. Улучшенная загрузка внеклеточных везикул, полученных из плазмы, для инкапсуляции противоопухолевых микроРНК. Mol Ther Methods Clin Dev. (2019) 13:133–44.doi: 10.1016/j.omtm.2019.01.001

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    120. Ламичане Т.Н., Райкер Р.С., Джей С.М. Загрузка экзогенной ДНК во внеклеточные везикулы посредством электропорации зависит от размера и обеспечивает ограниченную доставку генов. Мол Фарм. (2015) 12:3650–7. doi: 10.1021/acs.molpharmaceut.5b00364

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    121. Джеярам А., Ламичане Т.Н., Ван С., Цзоу Л., Дахал Э., Кронштадт С.М. и соавт.Повышенная загрузка функционального груза микроРНК посредством модификации градиента рН внеклеточных везикул. мол. тер. (2020) 28:975–85. doi: 10.1016/j.ymthe.2019.12.007

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    122. Хариса Г.И., Бадран М.М., Аланази Ф.К. Нановезикулы эритроцитов: биогенез, биологическая роль и терапевтический подход: нановезикулы эритроцитов. Saudi Pharm J. (2017) 25:8–17. doi: 10.1016/j.jsps.2015.06.010

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    124.Jank H, Salzer U. Везикулы, образующиеся при хранении эритроцитов, усиливают образование радикальных видов кислорода в активированных нейтрофилах. ScientificWorldJournal. (2011) 11:173–85. doi: 10.1100/tsw.2011.25

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    125. Minetti M, Agati L, Malorni W. Микроокружение может изменить поведение эритроцитов от дружественного к вредному: патогенетические последствия сосудистых заболеваний. Кардиоваскулярный рез. (2007) 75:21–8. doi: 10.1016/j.cardiores.2007.03.007

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    127. Buesing KL, Densmore JC, Kaul S, Pritchard KA Jr, Jarzembowski JA, et al. Эндотелиальные микрочастицы вызывают воспаление при остром повреждении легких. J Surg Res. (2011) 166:32–9. doi: 10.1016/j.jss.2010.05.036

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    129. Бернье Л., Фонтана П., Квак Б.Р., Анджелилло-Шеррер А.Микрочастицы клеточного происхождения в гемостазе и сосудистой медицине. Тромб Гемост. (2009) 101:439–51. дои: 10.1160/TH08-08-0521

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    130. Чанг С.М., Бэ О.Н., Лим К.М., Но Дж.И., Ли М.Ю., Юнг Ю.С. и др. Лизофосфатидная кислота индуцирует тромбогенную активность за счет воздействия фосфатидилсерина и образования прокоагулянтных микровезикул в эритроцитах человека. Артериосклеры Тромб Васк Биол. (2007) 27:414–21.doi: 10.1161/01.ATV.0000252898.48084.6a

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    132. Kleinegris MC, Koek GH, Mast K, Mestrom EH, Wolfs JL, Bevers EM. Вызванная рибавирином экстернализация фосфатидилсерина в эритроцитах преимущественно обусловлена ​​ингибированием активности аминофосфолипидтранслоказы. Евро J Pharmacol. (2012) 693:1–6. doi: 10.1016/j.ejphar.2012.07.041

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    133.Циакас Д.Н., Халикиас Г.К., Стакос Д., Будулас Х. Роль эритроцитов в прогрессировании и нестабильности атеросклеротических бляшек. Int J Кардиол. (2010) 142:2–7. doi: 10.1016/j.ijcard.2009.10.031

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    134. Тантави А.А., Адли А.А., Исмаил Э.А., Хабиб Н.М., Фарук А. Циркулирующие микрочастицы тромбоцитов и эритроцитов у детей раннего возраста и подростков с серповидно-клеточной анемией: связь с сердечно-сосудистыми осложнениями. Тромбоциты. (2013) 24:605–14. дои: 10.3109/09537104.2012.749397

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    135. Pham CT, Zhang X, Lam A, Le MT. Внеклеточные везикулы эритроцитов как надежные носители терапевтических средств на основе РНК. Клеточный стресс. (2018) 2: 239–41. дои: 10.15698/cst2018.09.155

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    137. Svensson KJ, Christianson HC, Wittrup A, Bourseau-Guilmain E, Lindqvist E, Svensson LM, et al.Поглощение экзосом зависит от передачи сигналов ERK1/2-белком теплового шока 27 и липидного Raft-опосредованного эндоцитоза, отрицательно регулируемого кавеолином-1. J Biol Chem. (2013) 288:17713–24. doi: 10.1074/jbc.M112.445403

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    139. Као С.Ю., Папуцакис Э.Т. Внеклеточные везикулы: экзосомы, микрочастицы, их части и их мишени для их биопроизводства и клинического применения. Курр Опин Биотехнолог. (2019) 60:89–98.doi: 10.1016/j.copbio.2019.01.005

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    141. Цзян Дж., Као CY, Папуцакис ET. Как мегакариоцитарные микрочастицы нацеливаются и доставляют груз, чтобы изменить судьбу гемопоэтических стволовых клеток? J Разблокировка управления. (2017) 247:1–18. doi: 10.1016/j.jconrel.2016.12.021

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    142. Borgheti-Cardoso LN, Kooijmans SAA, Chamorro LG, Biosca A, Lantero E, Ramirez M, et al.Внеклеточные везикулы, полученные из инфицированных и неинфицированных плазмодием эритроцитов, в качестве целевых средств доставки лекарств. Int J Фарм. (2020) 587:119627. doi: 10.1016/j.ijpharm.2020.119627

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    144. Rinalducci S, Ferru E, Blasi B, Turrini F, Zolla L. Окислительный стресс и опосредованная каспазой фрагментация цитоплазматического домена полосы 3 эритроцитов во время хранения крови. Переливание крови. (2012) 10 (Прил.2): с55–62. дои: 10.2450/2012.009S

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    146. Уизер М., Дзецятковска М., Немков Т., Строп П., Д’Алессандро А., Хансен К.С. Окисление гемоглобина по остаткам функциональных аминокислот при рутинном хранении эритроцитов. Переливание. (2016) 56:421–6. doi: 10.1111/trf.13363

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    147. Геви Ф., Д’Алессандро А., Ринальдуччи С., Золла Л.Изменения метаболома эритроцитов при хранении концентратов эритроцитов в жидкости на холоду в CPD-SAGM. Дж Протеомика. (2012) 76:168–80. doi: 10.1016/j.jprot.2012.03.012

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    148. Алмизрак Р.Дж., Головати Дж.Л., Акер Дж.П. Характеристики внеклеточных везикул в концентратах эритроцитов изменяются в зависимости от времени хранения и способа изготовления крови. Трансфус Мед Гематер. (2018) 45:185–93. дои: 10.1159/000486137

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    149. Бикальо Б., Перейра А.С., Акер Дж.П. Концентраты эритроцитов, полученные с помощью лейкоцитарной пленки (вверху/внизу) и фильтрации цельной крови (вверху/вверху), различаются по размеру внеклеточных везикул. Голосовая песня. (2015) 109: 214–20. doi: 10.1111/vox.12272

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    150. Shrestha RP, Horowitz J, Hollot CV, Germain MJ, Widness JA, Mock DM, et al.Модели продолжительности жизни эритроцитов. J Фармакокинета Фармакодин. (2016) 43:259–74. doi: 10.1007/s10928-016-9470-4

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    151. Soekmadji C, Li B, Huang Y, Wang H, An T, Liu C, et al. Будущее внеклеточных везикул как тераностики — отчет о встрече ISEV. J Внеклеточные везикулы. (2020) 9:1809766. дои: 10.1080/20013078.2020.1809766

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    152.Clayton A, Boilard E, Buzas EI, Cheng L, Falcon-Perez JM, Gardiner C, et al. Соображения относительно дорожной карты для сбора, обработки и хранения внеклеточных везикул крови. J Внеклеточные везикулы. (2019) 8:1647027. дои: 10.1080/20013078.2019.1647027

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    153. Meng W, He C, Hao Y, Wang L, Li L, Zhu G. Перспективы и проблемы системы доставки лекарств на основе внеклеточных везикул: рассмотрение клеточного источника. Делив наркотиков. (2020) 27: 585–98. дои: 10.1080/10717544.2020.1748758

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    155. Catalano M, O’Driscoll L. Ингибирование образования и высвобождения внеклеточных везикул: обзор ингибиторов EV. J Внеклеточные везикулы. (2020) 9:1703244. дои: 10.1080/20013078.2019.1703244

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    156. О’Брайен К., Брейн К., Угетто С., Лоран Л.С., Брейкфилд Х.О.Доставка РНК внеклеточными везикулами в клетки млекопитающих и ее применение. Nat Rev Mol Cell Biol. (2020) 21: 585–606. doi: 10.1038/s41580-020-0251-y

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    157. Рамсби М.Г., Троттер Дж., Аллан Д., Мичелл Р.Х. Восстановление мембранных микровезикул из эритроцитов человека, хранящихся для переливания: механизм преобразования формы эритроцитов из дискоцитов в сфероциты. Biochem Soc Trans. (1977) 5:126–8.дои: 10.1042/bst0050126

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    158. Sheng L, Stewart T, Yang D, Thorland E, Soltys D, Aro P, et al. Эритроцитарный альфа-синуклеин, содержащийся в микровезикулах, регулирует гомеостаз астроцитарного глутамата: новый взгляд на патогенез болезни Паркинсона. Acta Neuropathol Commun. (2020) 8:102. doi: 10.1186/s40478-020-00983-w

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    159.Кидд Л., Геддингс Дж., Хисада Ю., Суда М., Конкэннон Т., Николс Т. и др. Прокоагулянтные микрочастицы у собак с иммуноопосредованной гемолитической анемией. J Ветеринарный стажер Med. (2015) 29:908–16. doi: 10.1111/jvim.12583

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    160. Arvidsson I, Stahl AL, Hedstrom MM, Kristoffersson AC, Rylander C, Westman JS, et al. Шига-токсин, индуцированный комплемент-опосредованным гемолизом и высвобождением микровезикул, происходящих из эритроцитов, покрытых комплементом, при гемолитико-уремическом синдроме. Дж Иммунол. (2015) 194:2309–18. doi: 10.4049/jimmunol.1402470

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    161. Mantel PY, Hoang AN, Goldowitz I, Potashnikova D, Hamza B, Vorobjev I, et al. Микровезикулы, полученные из эритроцитов, инфицированных малярией, опосредуют клеточную связь внутри популяции паразита и с иммунной системой хозяина. Микроб-хозяин клетки. (2013) 13:521–34. doi: 10.1016/j.chom.2013.04.009

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    162.Беверс Э.М., Видмер Т., Комфуриус П., Шаттил С.Дж., Вайс Х.Дж., Звал Р.Ф. и соавт. Дефектная Ca(2+)-индуцированная микровезикуляция и недостаточная экспрессия прокоагулянтной активности в эритроцитах пациента с нарушением свертываемости крови: исследование эритроцитов при синдроме Скотта. Кровь. (1992) 79:380–8. doi: 10.1182/кровь.V79.2.380.380

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    163. Чен Ю, Ли Г, Лю МЛ. Микровезикулы как новые биомаркеры и терапевтические мишени при кардиометаболических заболеваниях. Геномика Протеомика Биоинформатика. (2018) 16:50–62. doi: 10.1016/j.gpb.2017.03.006

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Эффективная доставка РНК-препаратов с использованием внеклеточных везикул эритроцитов

    Клеточная культура

    Острый миелоидный лейкоз Клетки MOLM13 и NOMO1 были первоначально получены из коллекции микроорганизмов и клеточных культур DSMZ (Брауншвейг, Германия). Клетки рака молочной железы MCF10CA1a (CA1a) были приобретены в Karmanos Cancer Institute (Wayne State University, США).Клетки HEK-293T были получены из Американской коллекции типовых культур (ATCC, США). Клетки MCF10CA1a с меткой люциферазы были получены в нашем предыдущем исследовании 35 . Клетки 293T-eGFP, полученные из клеток ATCC HEK-293T, были подарком доктора Альберта Ченга (Jackson Lab, США). Клетки MOLM13 и NOMO1, стабильно экспрессирующие eGFP, были получены путем инфицирования лентивирусом pCAG-eGFP, полученным в клетках HEK-293T, котрансфицированных упаковывающими плазмидами с использованием Lipofectamin TM 2000 (плазмиды от Addgene, США) и отсортированы с использованием проточной цитометрии.Линии клеток лейкемии и рака молочной железы поддерживали в RPMI1640 или DMEM (ThermoFisher Scientific) соответственно с 10% фетальной бычьей сывороткой (Biosera, США) и 1% пенициллином/стрептомицином (ThermoFisher Scientific, США). Все клетки, использованные для экспериментов, дали отрицательный результат на заражение микоплазмой с помощью ПЦР. Вкратце, 100 мкл супернатантов собирали из 80–100% конфлюэнтных культур и нагревали при 95 °C в течение 5 минут. ДНК микоплазмы амплифицировали с использованием полимеразы Taq (подарок Xia lab, Xiamen University) и смеси специфичных для микоплазмы праймеров (последовательности представлены ниже) в 35 циклах: 94 °C 15 с, 56 °C 15 с, 72 ° С 30 с; и визуализировали с использованием 1% агарозного геля.Параллельно также тестировали микоплазмы с помощью набора для выявления микоплазм Mycofluor (ThermoFisher Scientific) согласно протоколу производителя. Ячейки MOLM13, NOMO1, CA1a и 293T были аутентифицированы их первоначальными поставщиками. Мы также подтвердили идентичность этих клеточных линий и их флуоресцентных/люциферазных производных с помощью мультиплексного анализа коротких тандемных повторов с 16 локусами в соответствии со стандартами ATCC, предоставленными службой аутентификации Guangzhou IGE Biotechnology (Китай).

    Очистка EV от эритроцитов

    Образцы крови группы O были получены Красным Крестом от здоровых доноров в Гонконге с информированного согласия.Все эксперименты с образцами крови человека проводились в соответствии с рекомендациями и одобрением Комитета по этике испытуемых Городского университета Гонконга. Эритроциты отделяли от плазмы и лейкоцитов с помощью центрифугирования и лейкодеплеционных фильтров (Terumo Japan). Изолированные эритроциты разводили в PBS и обрабатывали 10 мМ ионофором кальция (Sigma Aldrich) в течение ночи. Для очистки EVS, RBC и мусорных мусоров были удалены центрифугированием при 600 × г в течение 20 мин, 1600 × г в течение 15 минут, 3260 × г в течение 15 минут и 10 000 × г в течение 30 минут 4 °С.Супернатанты пропускали через шприцевые фильтры 0,45 мкм. ЭВ концентрировали ультрацентрифугированием на роторе TY70Ti (Beckman Coulter, США) при 100 000 ×  g в течение 70 мин при 4 °C. ЭВ ресуспендировали в холодном PBS. Для мечения половину ЭВ смешивали с 20 мкМ ПХ36 (Sigma Aldrich, США) или 1 мкМ DiR (ThermoFisher Scientific) или 42,62 мкМ Vivo-Track-680 (Perkin Elmer). Меченые или немеченые ЭВ наслаивали на 2 мл замороженной 60% сахарозной подушки и центрифугировали при 100 000× мкг в течение 16 ч при 4°C с использованием ротора SW41Ti (Beckman Coulter) с пониженной скоростью торможения.Красный слой ЭВ (над сахарозой) собирали и промывали один раз (немеченые ЭВ) или дважды (меченые ЭВ) холодным PBS с использованием ультрацентрифугирования в роторе SW41Ti (Beckman Coulter) при 100 000 ×  g в течение 70 мин при 4 °С. С. Все эксперименты по ультрацентрифугированию проводили на ультрацентрифуге Beckman XE-90 (Beckman Coulter). Очищенные RBCEV хранили при температуре -80 °C.

    Характеристика ЭВ

    Концентрацию и распределение ЭВ по размерам определяли количественно с использованием системы NanoSight Tracking Analysis NS300 (Malvern, UK).Дзета-потенциал и индекс полидисперсности определяли с использованием Zetasizer Nano (Malvern). Для анализа ЭМ с помощью просвечивающей электронной микроскопии ЭВ фиксировали на медных сетках (200 меш, покрытых формваровой углеродной пленкой) путем добавления равного количества 4% параформальдегида. После промывки PBS добавляли 4% уранилацетата для химического окрашивания электромобилей, и изображения получали с помощью просвечивающего электронного микроскопа Tecnai 12 BioTWIN (FEI/Philips, США).

    Олигонуклеотидные последовательности и модификации

    ASO анти-миР-125b (5′-UCACAAGUUAGGGUCUCAGGGA-3′) и ASO отрицательного контроля (5′-CAGUACUUUUGUGUAGUACAA-3′) были синтезированы с 2′-O-метильной модификацией каждого рибонуклеотида компанией Shanghai Genepharma (Шанхай, Китай) или Integrated DNA Technology (Сингапур).ГРНК против miR-125b (5′-CCUCACAAGUUAGGGUCUCA-Synthego Scaffold -3′) и гРНК против GFP: (5′-GGGCACGGGCAGCUUGCCGG- Synthego Scaffold -3′) синтезировали с 2′-O-метиловыми аналогами и 3′-фосфотиоатом. межнуклеотидные связи по первым трем 5′- и 3′-концевым остаткам РНК Synthego (США).

    Электропорация EV

    Электропорацию RBCEV проводили с использованием электропоратора Gene Pulser Xcell (BioRad), экспоненциальной программы при фиксированной емкости 100 мкФ с кюветами 0,4 см.Для оптимизации от 8,25 до 16,5 × 10 11 RBCEV разводили в OptiMEM (ThermoFisher Scientific) и смешивали с 4 мкг декстрана, конъюгированного с Alexa Fluor ® 647 (AF647, ThermoFisher Scientific), до общего объема 200 мкл. В каждую кювету добавляли аликвоту 100 мкл смеси EV и инкубировали на льду в течение 10 мин. Электропорацию тестировали при различных напряжениях: 50–250   В. Для доставки ASO ~ 4–16   ×   10 11 RBCEV подвергали электропорации с 400 пмоль скремблированного отрицательного контроля (NC) или анти-миР-125b ASO при 250   В.Для редактирования генома 12,4 × 10 11 клеток RBCEV (или клеток MOLM13) подвергали электропорации с 6 пмоль мРНК CleanCap TM Cas9 (Trilink) и 50 пмоль гРНК анти-GFP или 80 пмоль гРНК анти- mir-12552 mir-12552. при 400  В. Агрегаты RBCEV, образовавшиеся во время электропорации, растворяли энергичным пипетированием. Для количественной оценки эффективности электропорации 8,25 × 10 11 электропорированных EV647 Dextran-AF647 инкубировали в течение ночи с 5  мкг латексных шариков (ThermoFisher Scientific) и анализировали на AF647 с помощью проточной цитометрии.

    Эффективность загрузки РНК и стабильность в электропорированных RBCEV

    Для количественного определения количества несвязанных ASO 200 пмоль немеченых или FAM-меченых NC-ASO загружали с или без 8,25 × 10 11 RBCEV, с электропорацией или без нее, в 10 % нативного геля трис-ацетат-ЭДТА (ТВЕ), разделенного при 150 В в течение 30 мин и визуализированного с помощью окрашивания SYBR-Gold в течение 30 мин при комнатной температуре (ThermoFisher Scientific) или с использованием флуоресценции FAM, соответственно, с помощью Gel Doc TM EZ Система документации (Bio-Rad, США).Эксперимент был повторен независимо трижды. Полосы SYBR Gold ASO были количественно определены с использованием imageJ (NIH, США) и нормализованы к фону. Полные изображения гелей представлены на дополнительном рисунке 17.

    Для определения стабильности ASO в электропорированных EV, 6,2 × 10 11 RBCEV и 200 пмоль FAM ASO, неэлектропорированные или электропорированные смеси, инкубировали с 50% FBS в OptiMEM. при 37 °C в течение 1–72 ч. Смеси вносили в 96-луночный черный планшет с прозрачным дном (Perkin Elmer, США) и анализировали флуоресценцию FAM с помощью микропланшет-ридера Synergy TM h2 (BioTek, США).

    Для количественной оценки эффективности электропорации ASO 6,2 × 10 11 RBCEV, электропорированных с 200 пмоль 125b-ASO, или такое же количество неэлектропорированных EV и 125b-ASO инкубировали со 100 единицами РНКазы I f (New England Biolabs, США) при 37 °C в течение 30 мин. РНКазу инактивировали нагреванием путем инкубации при 70°С в течение 10 мин. В каждый образец добавляли Trizol-LS (ThermoFisher Scientific) и экстрагированную РНК подвергали обратной транскрипции, как описано ниже. Аналогично 6.2 × 10 11 RBCEV, электропорированных с 1 мкг мРНК Cas9 или с таким же количеством неэлектропорированной мРНК Cas9 , инкубировали с 25 ед. -ПЦР Cas9 мРНК.

    Разделение EV с использованием нисходящих градиентов плотности сахарозы

    Всего 3,7 × 10 12 EV, нагруженных FAM ASO, смешивали с 1 мл 10% раствора HEPES/сахарозы. 11 мл линейного градиента сахарозы (60–10%) загружали в 12.Ультрацентрифужная пробирка SW41 объемом 5 мл с открытым верхом (Beckman Coulter). Суспензию ЭВ наслаивали поверх слоя сахарозы и ультрацентрифугировали при 150 000 × g в течение 16 ч при 4 °C. В общей сложности 12 фракций собирали из градиента сахарозы в планшет с черными лунками и анализировали с помощью устройства для чтения микропланшетов Synergy™ h2. Концентрацию ЭВ в каждой фракции определяли с помощью NanoSight, как описано выше. Плотность сахарозы в каждой фракции измеряли с помощью рефрактометра (VastOcean, Китай).

    Лечение раковых клеток с помощью RBCEV in vitro

    Мы проводили контроль качества RBCEV для каждой партии очистки с использованием анализатора частиц Nanosight. Образцы с необычно низкой концентрацией или странными агрегатами отбрасывались. Клетки в культуре регулярно исследовали на наличие признаков загрязнения или изменений в морфологии и росте. Чтобы проверить поглощение EV, 50 000 клеток MOLM13, CA1a или NOMO1 инкубировали с 200 мкл ~ 4–16   × 10 11 неэлектропорированных или электропорированных EV и 300 мкл ростовой среды на лунку в 24-луночных планшетах в течение 24 часов.Необработанные контроли содержались в той же среде с 200 мкл необработанного OptiMEM. Для анализов, требующих более длительного времени инкубации, среду заменяли свежей ростовой средой через 24 часа. Для сравнения, клетки MOLM13 трансфицировали 4 мкг декстрана-AF647 или 800 нМ FAM-меченых NC-ASO в Lipofectamin TM 3000 (ThermoFisher Scientific) или INTERFERin ® (PolyPlus Transfection, Франция) в соответствии с протоколами производителей. Чтобы проверить влияние гепарина на поглощение, клетки MOLM13 предварительно обрабатывали 20 мкг/мл натриевой соли гепарина (Aladdin, Китай) в течение 10 минут, а затем инкубировали в течение ночи с 12.4 × 10 11 немеченых или меченных РХ36 RBCEV в присутствии или в отсутствие 20 мкг/мл натриевой соли гепарина. Поглощение RBCEV и ASO декстрана или FAM анализировали с помощью проточной цитометрии или иммуноокрашивания.

    Проточная цитометрия

    Проточная цитометрия латексных шариков или клеток в буфере FACS (PBS, содержащий 0,5% фетальной телячьей сыворотки) проводили с использованием цитометра CytoFLEX-S (Beckman Coulter) или цитометра SH800Z (Sony Biotechnology, США) и анализировали с помощью Flowjo V7 или V10 (Flowjo, США).GFP-положительные клетки MOLM13 или NOMO1 отбирали с использованием сортировщика клеток Sony SH800Z в стерильных условиях. Гранулы или клетки изначально были закрыты на основе FSC-A и SSC-A, чтобы исключить дебрис и мертвые клетки (низкий FSC-A), как показано на дополнительных рисунках. 3, 16. Клетки дополнительно отбирали на основе ширины FSC по сравнению с высотой FSC, чтобы исключить дублеты и агрегаты. При анализе клеток GFP +  из костного мозга лейкемических мышей NSG, живые клетки также были отобраны из популяции одиночных клеток на основе Cytox blue-негативного (канал PB450).Впоследствии флуоресцентно-положительные гранулы или клетки были включены в соответствующие флуоресцентные каналы: FITC для FAM и GFP, PE для PKh36 и PI, APC для AF647 и APC-Cy5.5 для VVT, как популяции, которые демонстрировали незначительные сигналы в неокрашенные/необработанные отрицательные контроли, как показано в примере на дополнительных рис. 3, 16. FCS и файлы анализа представлены на figshare.

    Вестерн-блот-анализ

    Суммарные клеточные лизаты экстрагировали из ЭВ или клеток (клетки из 3 лунок 24-луночных планшетов объединяли для каждого условия) путем инкубации с буфером RIPA, дополненным ингибиторами протеазы (Biotool).В общей сложности 30 или 35  мкг белковых лизатов разделяли на 10% полиакриламидных гелях и переносили на нитроцеллюлозную мембрану (GE Healthcare). С двух сторон образцов наносили трехцветную белковую шкалу PM5100 ExcelBand™ (SmoBio, Тайвань). Мембраны разрезали горизонтально на две-четыре части по лестнице, блокировали 5% обезжиренным молоком в трис-буферном солевом растворе, содержащем 0,1% Tween-20 (TBST), в течение 1 ч при комнатной температуре и инкубировали с первичными антителами в течение ночи при 4°С. C: мышиное антитело к Alix (клон 3A9, кат. № SC-53538, Санта-Круз, разведение 1:500), мышиное анти-Tsg101 (клон C-2, кат. № SC-7964, Санта-Круз, разведение 1:500), антигемоглобин α кролика (клон Н-80, SC-21005, Санта-Крус, разведение 1:1000), анти-Кальнексин мыши (клон AF18, SC-23954, Санта-Крус, разведение 1:500), антистоматин мыши ( клон E-5, SC-376869, Санта-Крус, разведение 1:1000), кроличье антитело к GAPDH (клон FL-335, кат. № SC-25778, Санта-Крус, разведение 1:1000), антитело мыши к Cas9 (клон 7A9, кат. № 844301, BioLegend, разведение 1:250) и мышиный антитубулин (клон DM1A, кат. № Ab7291, Abcam, разведение 1:1000).Блот трижды промывали TBST, затем инкубировали с HRP-конъюгированными антимышиными и антикроличьими вторичными антителами (кат. № 715-035-150 и 711-035-152, Jackson ImmunoResearch, разведение 1:10 000) в течение 1 ч при комнатной температуре. Изображение блота было получено с помощью системы документирования геля Azure Biosystems. Полные изображения пятен представлены на дополнительном рисунке 18. Интенсивность полос была количественно определена и вычтена из фона с помощью ImageJ.

    Экстракция РНК и qRT-PCR

    Тотальную РНК экстрагировали из клеток или тканей с использованием Trizol (ThermoFisher) в соответствии с инструкциями производителя.Образцы РНК определяли количественно и квалифицировали с использованием анализа NanoDrop (ThermoFisher) и 1% агорозных гелей. Те, что имели достаточную концентрацию (>30 нг/мкл), чистоту (A260/280 > 1,7) и целостность (чистые полосы 28 и 18s рРНК), были преобразованы в кДНК с использованием набора для обратной транскрипции кДНК большой емкости (ThermoFisher) в соответствии с протоколом производителя. Уровни миР-125a и миР-125b количественно определяли с помощью анализов микроРНК Taqman ® (ThermoFisher), нормированных к экспрессии мяРНК U6b, или с помощью ПЦР микроРНК miRCURY™ LNA™ Universal RT (Qiagen, Германия), нормированных к экспрессия миР-103a.Анти-миР-125b ASO количественно определяли с использованием анализа микроРНК Taqman ® (ID # 007655_mat), нормализовали к экспрессии мяРНК U6b, или количество ее копий рассчитывали на основе стандартной кривой значений порогового цикла (Ct) ASO по сравнению с концентрация АСО в серийном разведении от 0,001 до 1000 пМ. qRT-PCR анализ мРНК проводили с использованием Ssofast TM Evagreen (SYBR Green) qPCR master mix (Bio-Rad), нормализованной по экспрессии GAPDH , или 18s рРНК , или ACTB .Все реакции количественной ПЦР проводили с использованием системы обнаружения ПЦР в реальном времени CFX96 Touch™ (Bio-Rad).

    Секвенирование

    mir-125b гена

    Для идентификации событий редактирования генома, генерируемых mir-125b , нацеленным на гРНК и Cas9 , нагруженных мРНК RBCEV, ДНК экстрагировали из обработанных EV клеток MOLM13, а затем с помощью тризола. -осаждение хлороформом и этанолом. Первичная последовательность hsa-mir-125b-2 (383 нуклеотида) была амплифицирована с использованием пары ген-специфических праймеров (последовательности представлены ниже) и высококачественной мастер-микса Q5 ® Hot Start (New England Biolabs) в 30 циклы: 98 °C 10 с, 64 °C 30 с, 72 °C 45 с и конечное расширение 72 °C в течение 2 мин.Продукт ПЦР повторно амплифицировали с использованием тех же праймеров с метками секвенирования. Высокосквозное секвенирование выполнено компанией NovoGene Sequencing (Гонконг) с использованием парно-концевой платформы HiSeq (Illumina, США).

    последовательностей праймеров

    GAPDH Вперед: GGAGCGAGATCCCTCCAAAAT

    GAPDH Обратный: GGCTGTTGTCATACTTCTCATGG

    18s РНК Вперед: GTAACCCGTTGAACCCCATT

    18s РНК Реверс: CCATCCAATCGGTAGTAGCG

    BAK1 Вперед: TGGTCACCTTACCTCTGCAA

    BAK1 Обратный: TCATAGCGTCGGTTGATGTC

    SP-cas9 Вперед: AAGGGACAGAAGAACAGCCG

    SP-cas9 Обратный: ATATCCCGCCCATTCTGCAG

    Mir-125b Вперед: AATGGTCGTCGTGATTACTCA

    Mir-125b Обратный: TTTTGGGGATGGGTCATGGT

    ACTB вперед : TCCCTGGAGAAGAGCTACGA

    ACTB Реверс: AGGAAGGAAGGGTGGAAGAG

    микоплазма-1 Вперед: CGCCTGAGTAGTACGTTCGC

    микоплазма-2 Вперед: CGCCTGAGTAGTACGTACGC

    микоплазма-3 Вперед: TGCCTGAGTAGTACATTCGC

    микоплазма-4 Forwa го: TGCCTGGGTAGTACATTCGC

    микоплазма-5 Вперед: CGCCTGGGTAGTACATTCGC

    микоплазма-6 Вперед: CGCCTGAGTAGTATGCTCGC

    микоплазма-1 Реверс: GCGGTGTGTACAAGACCCGA

    микоплазма-2 Реверс: GCGGTGTGTACAAAACCCGA

    микоплазма-3 Реверс: GCGGTGTGTACAAACCCCGA

    Все праймеры были синтезированы Пекинский институт геномики (Китай).

    Количественная оценка жизнеспособности клеток

    Для анализа методом проточной цитометрии лейкозные клетки окрашивали йодидом пропидия (PI) в течение 15 минут при комнатной температуре, промывали буфером FACS и анализировали с использованием цитометра CytoFLEX-S, как описано выше. Для анализа на планшете 50 000 клеток CA1a высевали на лунку в 24-луночные планшеты и обрабатывали RBCEV, подвергнутыми электропорации ASO. Через 3 дня клетки один раз промывали PBS и инкубировали с 0,5% раствором для окрашивания кристаллическим фиолетовым (Sigma Aldrich).Затем планшеты трижды промывали в токе водопроводной воды и сушили на воздухе. После этого в каждую лунку добавляли 500 мкл 50% уксусной кислоты и измеряли оптическую плотность при 570 нм с помощью ридера для микропланшетов Biotek.

    Эксперименты на животных

    Все эксперименты на мышах проводились в соответствии с нашими экспериментальными протоколами, одобренными комитетами по этике животных в Городском университете Гонконга и Департаментом здравоохранения САР Гонконг, в соответствии с государственным законодательством, в том числе о животных (Контроль экспериментов). ) Постановление (гл.340) и Постановления о предотвращении жестокого обращения с животными (глава 169). Голые мыши (штамм NU/J 002019) и мыши NSG (NOD.CgPrkdc < scid > Il2rg < tm1Wjl > /SzJ 005557) были приобретены в лаборатории Джексона (США) и выведены в наших условиях. Мышей одинакового возраста помечали цифрами на ушных бирках или хвостах с использованием постоянных маркеров и рандомизировали в контрольную и экспериментальную группы без какой-либо предвзятости в отношении родителей, веса, размера или пола (за исключением экспериментов с раком молочной железы, которые проводились только на самках мышей). ).Большинство экспериментов по визуализации и гистопатологии проводились вслепую, поскольку исследователи, проводившие сбор данных, отличались от тех, кто проводил лечение. Данные были записаны на основе количества мышей, а не их групп лечения. Мыши, забеременевшие или погибшие случайно из-за анестезии во время экспериментов, были исключены. Мы также исключили ложноположительные или отрицательные результаты из-за других технических проблем, таких как неудачные инъекции.

    Определение поглощения и биораспределения EV in vivo

    Всего 5 × 10 6 клеток CA1a в 50 мкл PBS смешивали с равным объемом холодного Matrigel (Corning) и вводили подкожно в левый и правый бок 6 -недельные самки голых мышей.Через 1 неделю, когда диаметр опухоли приближается к 7 мм, каждой мыши инъецировали 16,5×10 11 меченных РХ36 RBCEV внутри опухоли в левый бок. Затем мышей кормили диетой без люцерны (LabDiet, США) для снижения аутофлуоресценции в пищеварительной системе. Флуоресценцию ПК36 измеряли ежедневно с помощью системы IVIS Lumina III (Caliper Life Sciences, США). На 3-й день мышей забивали, опухоли вырезали и визуализировали на РХ36. Замороженные срезы опухолей окрашивали DAPI и наблюдали под конфокальным лазерным сканирующим микроскопом LSM-880 NLO (Zeiss, Германия).Точно так же мышам с опухолью CA1a (7  мм) вводили внутрибрюшинно. с 16,5 × 10 11 РХ36 или DiR-мечеными RBCEV или супернатант последней промывки после мечения EV. Изображения мышей, которым вводили DiR-EV, были получены через 24 часа после лечения с использованием IVIS Lumina III. Опухоли, печень, сердце, легкие, селезенку, почки, желудок и кишечник также получали из внутрибрюшинно. Мыши, которым вводили DiR/PKh36-EV, для визуализации IVIS и гистопатологического анализа.

    Чтобы определить биораспределение RBCEV у мышей NSG, 3.3 × 10 12 DiR-меченые RBCEV или супернатант последней отмывки EV вводили двукратно с интервалом 24 часа мышам NSG в возрасте 6–8 недель (Jackson Lab). После этого мышей убивали и собирали органы для флуоресцентной визуализации DiR с использованием системы IVIS Lumina III. Флуоресцентные изображения всего тела и тканей были получены и проанализированы с использованием программного обеспечения Living Image ® (Caliper Life Sciences). Фон и аутофлуоресценция определялись с использованием необработанных или надосадочных отрицательных контролей и вычитались из изображений с использованием функции Image-Math.

    Для определения захвата RBCEV клетками костного мозга 3,3 × 10 12 VVT-меченых RBCEV или супернатант последней промывки EV вводили дважды с интервалом в 24 часа мышам NSG в возрасте 6–8 недель. (4 мыши/группа). Через 24 часа после второй инъекции мышей умерщвляли и собирали их костный мозг путем промывки буфера FACS через раздробленные кости с помощью шприца и иглы G25. Клетки фильтровали через сито 70 мкм, центрифугировали при 1500 об/мин в течение 5 минут, ресуспендировали в буфере FACS и анализировали на флуоресценцию VVT (APC-Cy5.5 канал) с использованием цитометра Sony SH800Z, как описано выше.

    Стабильность RBCEV в кровотоке

    Всего было введено 3,3 × 10 12 ВВ, меченных ПКХ36, в/в. в хвостовые вены 6-недельных мышей NSG (Jackson Lab). Мышей забивали сразу или через 3, 6 и 12 ч после инъекции. Кровь собирали из сердца в пробирки с ЭДТА и центрифугировали при 800 ×  g в течение 5 мин. Супернатант разбавляли 10 мл холодного PBS и центрифугировали при 10000× g в течение 15 минут и пропускали через 0.Фильтр 45 мкм для удаления мусора. После этого ЭВ ультрацентрифугировали при 100 000 ×  г в течение 90 минут при 4 °C. Очищенные ЭВ ресуспендировали в 175 мкл PBS и инкубировали с 2,5 мкг латексных шариков при 37°С в течение 30 мин с последующей инкубацией в течение ночи при 4°С. Связанные с EV латексные шарики промывали 1 мл буфера FACS при 4000 ×  г в течение 10 мин и анализировали флуоресценцию ПХ36 с использованием цитометра CytoFLEX-S (Beckman).

    Доставка АСО in vivo к опухолям молочной железы

    В общей сложности 5 × 10 5 клеток CA1a, меченных люциферазой, смешивали с равным объемом матригеля и вводили в бока 6-недельным самкам бестимусных мышей.Через 24 часа каждой мыши вводили подкожно 8,25 × 10 12 NC/125b-ASO ( n  = 8 мышей) или 400 пмоль несвязанных NC/125b-ASO ( n  = 6 мышей). фланг в том же месте, где были введены опухолевые клетки. Внутриопухолевые инъекции АСО-электропорированных ЭВ повторяли каждые 3 дня до 42-го дня. Биолюминесцентные изображения всего тела получали каждые 6 дней с использованием системы IVIS Lumina III после внутрибрюшинного введения. инъекция 150 мг/кг d-люциферина (Caliper Life Sciences).Все биолюминесцентные изображения были получены и проанализированы с использованием Living Image ® 4.5. программное обеспечение вслепую (Caliper Life Sciences). На 44-й день мышей умерщвляли и вырезали опухоли. Половину каждой опухоли гомогенизировали в Тризоле для выделения РНК и проведения количественной ПЦР в реальном времени miR-125b, за исключением образцов РНК из нескольких опухолей, которые не соответствовали требованиям контроля качества (как описано выше). Другую половину опухоли и легкого фиксировали для гистопатологического анализа, как описано ниже.

    Доставка АСО in vivo мышам с трансплантированным лейкозом

    Мышам NSG в возрасте 7–8 недель вводили инъекцию i.п. с 20 мг/кг бусульфана (Санта-Круз). Через 24 часа 5 × 10 5 клеток MOLM13, меченных люциферазой и GFP, вводили в хвостовую вену мышей, обработанных бусульфаном. Через неделю измеряли биолюминесценцию с помощью IVIS Lumina III. Мышей с успешным приживлением лейкозных клеток (что показано биолюминесцентными сигналами в костном мозге) лечили 3,3 × 10 12 ЭВ, нагруженными АСО, внутрибрюшинно. через день в течение 9 дней (всего 5 доз). Люминесцентные изображения всего тела получали каждые 3 дня с помощью системы IVIS Lumina III после i.п. инъекция 150 мг/кг d-люциферина слепым методом (Caliper Life Sciences). Через 9 дней лечения мышей забивали. Костный мозг собирали и анализировали на GFP-положительные клетки с использованием FACS. Вкратце, клетки собирали из бедренной или большеберцовой кости убитых мышей путем промывания буфера FACS через раздробленные кости с помощью шприца и иглы G25. Клетки фильтровали через сито 70 мкм, центрифугировали при 1500 об/мин в течение 5 минут, ресуспендировали в 0,5 мл буфера для лизата эритроцитов (0,8% Nh5Cl и 0.1 мМ ЭДТА в воде, забуференной KHCO3, для достижения конечного pH 7,2–7,6) и инкубировали на льду в течение 5 минут. Буфер нейтрализовали 5 мл DMEM, содержащей 10% FBS. Клетки снова центрифугировали, один раз промывали PBS и ресуспендировали в 200 мкл буфера FACS. 0,5 мкл Cytox blue (ThermoFisher Scientific) добавляли для идентификации мертвых клеток. Селезенку и печень собирали в тризоле или формалине для выделения РНК и гистопатологического анализа соответственно. Образцы РНК использовали для qRT-PCR miR-125b, за исключением тех, которые не соответствовали контролю качества (как описано выше).

    Гистопатология

    Опухоли и другие ткани мышей фиксировали в 10% забуференном формалине (ThermoFisher Scientific) в течение ночи при комнатной температуре, обезвоживали последовательно в 70, 95 и 100% спирте при 37°С, очищали в трех ваннах с ксилолом (ThermoFisher Scientific) и пропитывали в трех ваннах с парафином (ThermoFisher Scientific) по 1 ч и 30 мин при 37 и 62°С соответственно. Парафиновые блоки вырезали толщиной 5 мкм с помощью микротома (модель MICROM: HM330). Перед окрашиванием срезы высушивали в инкубаторе при 37 °C.Срезы депарафинировали в двух ваннах с ксилолом, затем погружали в две ванны с абсолютным спиртом и одну ванну с 70%-ным спиртом, каждую на 10 мин. Срезы регидратировали в воде и окрашивали гематоксилином Гилла (Surgipath) в течение 15 мин. После промывки водой окрашенные срезы дифференцируют в 0,3%-ном кислом спирте, снова промывают водой и окрашивают в 2%-й раствор бикарбоната натрия. Микроскопическое исследование необходимо для проверки отчетливого окрашивания ядер с чистой цитоплазмой и фоном. Затем срезы окрашивали 0.5% эозин в течение 2 мин. После быстрой промывки водой для удаления избытка эозина (Merck) срезы обезвоживали в 95% и абсолютном спирте. Затем срезы очищали в ксилоле и монтировали с синтетической средой (Shandon).

    Иммуноокрашивание

    Клетки MOLM13 фиксировали 4% параформальдегидом (Sigma Aldrich) и прикрепляли к предметным стеклам с помощью цитоспина при 400 об/мин в течение 3 мин. Клетки блокировали 5% нормальной ослиной сывороткой (Jackson Immuno Research), пермеабилизировали 0,2% Triton X-100 и инкубировали в течение ночи с мышиным антителом против HA (Clone F-7, кат. № 7392, Cell Signaling Technology, 1). :250 разведение) при 4°C, трижды промывали PBS и инкубировали с ослиным вторичным антителом Alexa Fluor ® 488 против мышиных вторичных антител (Jackson Immuno Research) в течение 1 ч при комнатной температуре.Наконец, клетки окрашивали Hoechst (Sigma Aldrich) в течение 5 минут при комнатной температуре и трижды промывали PBS. В эксперименте по поглощению EV (рис. 1f) клетки окрашивали только Hoechst, но не каким-либо антителом. Изображения были получены с помощью вертикального флуоресцентного микроскопа Nikon Eclipse Ni-E. Изображения были проанализированы с помощью ImageJ. Количество Cas9-HA-положительных ядер подсчитывали и нормализовали по количеству Hoechst-положительных ядер на том же изображении. Средний процент Cas9-HA-положительных клеток рассчитывали по трем образцам при каждой обработке.

    Статистический анализ

    Стьюдента t -критерии, рассчитанные с помощью Microsoft Excel, использовались для вычисления значимости между обработанными образцами и контролями; тип теста был установлен на одностороннее распределение и равную дисперсию с двумя выборками. Критерий Манна-Уитни (односторонний), рассчитанный с помощью GraphPad Prism 6, использовался для расчета значимости, когда данные не подчинялись нормальному распределению. Односторонний ANOVA, рассчитанный с помощью GraphPad Prism 6, использовался для анализа данных, включающих несколько групп обработок.Все P -value < 0,05 считались значимыми. На всех графиках данные представлены как среднее ± стандартная ошибка среднего (SEM). Для количественной оценки каждый эксперимент обычно повторяли три раза с RBCEV от трех доноров или с клетками из трех клеточных пассажей. Эксперименты на мышах проводили с группами от 3 до 8 мышей. Минимальный размер выборки, равный 3, был определен с использованием анализа G*Power для одностороннего t -критерия сравнения средней разницы двух независимых групп с размером эффекта d  = 5; α вероятность ошибки = 0.05 и мощность = 0,95.

    Доступность данных

    Данные, полученные в ходе этого исследования, доступны на сайте figshare.com, включая необработанные данные, подтверждающие рис. 1 (https://doi.org/10.6084/m9.figshare.5931136), рис. 2 (https:// doi.org/10.6084/m9.figshare.5923570), рис. 3 (https://doi.org/10.6084/m9.figshare.593113), рис. 4 (https://doi.org/10.6084/m9. figshare.5931724), рис. 5 (https://doi.org/10.6084/m9.figshare.5931733), рис. 6 (https://doi.org/10.6084/m9.figshare.5931970), рис. 7 (https://doi.org/10.6084/m9.figshare.5932261) и рис. 8 (https://doi.org/10.6084/m9.figshare.5932654). Данные секвенирования следующего поколения мутантов mir-125b доступны в базе данных Bioproject: ID # PRJNA433779. Все остальные данные можно получить у авторов по обоснованному запросу.

    Условия хранения определяют характеристики внеклеточных везикул, полученных из эритроцитов

    Успех выделения REV был подтвержден изображениями динамического светорассеяния (DLS) и комбинированной TEM (FF-TEM).В целом были обнаружены частицы неоднородного размера со средним диаметром   ~   200 нм (рис. 1).

    Рисунок 1

    Характеристика образцов REV, выделенных из хранящихся (SAGM) эритроцитов через 21 день: ( A ) гидродинамический диаметр (со стандартным отклонением) и распределение по размерам, измеренное с помощью DLS; ( B ) типичное изображение FF-TEM.

    Несмотря на простоту и скорость типичных измерений DLS, неспособность метода надежно охарактеризовать распределение полидисперсных частиц по размерам делает его менее подходящим для количественного анализа частиц, происходящих из биожидкостей 39 .Микрожидкостное резистивное импульсное зондирование (MRPS) предлагает количественное определение распределения по размерам на основе принципа Коултера: оно обнаруживает отдельные наночастицы путем измерения изменений электрического тока, когда каждая частица проходит через нанопору 40,41 . На рисунке 2 показано распределение размеров образцов REV, полученных в разное время изоляции, с логарифмически нормальным распределением.

    Рисунок 2

    Распределение размеров и концентрация образцов REV, измеренные с помощью микрофлюидного резистивного импульсного зондирования (MRPS).Столбики погрешностей соответствуют ошибкам подсчета для каждой ячейки размера.

    По результатам MRPS (рис. 2) также отмечена субпопуляция частиц диаметром около 100 нм. Сателлитные пики на деконволютивных кривых предполагают, что наночастицы помимо REV также присутствуют. Бимодальное распределение частиц также наблюдали Nguyen et al., исследуя внеклеточные везикулы, высвобождаемые из эритроцитов в условиях стимуляции захвата Ca 2+ , с использованием сканирующей электронной микроскопии (СЭМ) и атомно-силовой микроскопии (АСМ).Они идентифицировали две популяции диаметром около 200 и 125 нм. Бимодальное распределение также наблюдается в случае REV, образованных из эритроцитов на ранней стадии хранения (3 дня), когда они хранились в изотоническом буфере PBS. Однако в буфере PBS после хранения в течение одной недели или более были обнаружены только почти монодисперсные ЭВ диаметром приблизительно 150 нм.

    С увеличением времени хранения увеличивается общая концентрация частиц; среда SAGM и PBS вызвала ту же тенденцию.Almizraq и коллеги, используя проточную цитометрию и методы настраиваемого резистивного импульсного зондирования, также выявили увеличение общей концентрации REV с увеличением времени гипотермического хранения 13 . Действительно, мы наблюдали линейное увеличение на порядки общей концентрации частиц со временем хранения (рис. 3А). Интересно отметить, однако, что в PBS общее образование частиц (везикул и наночастиц) более повышено: общее количество частиц, образованных из эритроцитов, хранящихся в среде SAGM, более чем в десять раз меньше, чем их аналоги из изотонического буферного хранения PBS. (1.77 . 10 9  ± 6,12 . 10 7 против 6,03 . 10 10  ± 4,46 . 10 8 , 4.41 . 10 10  ± 2,53 . 10 9 против 2,05 . 10 12  ± 1,53 . 10 10 и 1,74 . 10 11  ± 1,63 . 10 9 против 4,46 . 10 12  ± 2,76 . 10 10 для образцов за 3 дня, 8 дней и 21 дня соответственно).Соответственно, эритроциты, хранящиеся в аддитивном растворе САГМ, подвергаются менее выраженной везикуляции. Это соответствует объяснению Salzer et al. 2 , что индуцированные накоплением микровезикулы возникают в результате потери АТФ-зависимой транслоказы 42 . Действительно, используемый в настоящее время раствор солевого раствора, аденина, глюкозы и маннита (SAGM) для хранения крови, который содержит субстраты для производства 2,3-DFG и АТФ, сохраняет целостность эритроцитов в течение более длительного времени 43 .

    Рисунок 3

    Общее количество частиц (наночастиц и РЗВ), определенное измерениями MRPS в диапазоне размеров от 65 до 400 нм ( A ), и пиковая высота пика флуоресценции РЭВ с использованием PE-CD235a ( B ).Столбики погрешностей соответствуют стандартным отклонениям.

    Анализ MRPS был расширен эксклюзионной хроматографией в сочетании с флуоресцентным детектированием (Flu-SEC). Образцы REV метили конъюгированным с флуорохромом антителом (PE-antiCD235a) против гликофорина А, характерного мембранного белка эритроцитов. На рисунке 3B показана интенсивность флуоресценции фикоэритрина (PE-анти-CD235a), связанного с везикулами, происходящими из эритроцитов. На основании работы Kitka et al. 44 высота пика может быть напрямую связана с количеством REV при условии одинаковой плотности антигена.Однако это предположение не является тривиальным для РВ, выделенных в разное время хранения и на разных средах. Тем не менее, после сравнения результатов MRPS и Flu-SEC можно сделать вывод, что концентрация REV увеличивается со временем хранения, и она выше при хранении эритроцитов в PBS вместо SAGM.

    Чтобы получить представление о химическом составе образцов REV, были проанализированы ИК-спектры различных субпопуляций REV (рис. 4). Полосы, соответствующие колебаниям амида A, амида I и амида II (при 3288, 1654 и 1542 см -1 соответственно) белкового остова, обычно доминируют в спектрах 35,45 .Помимо амидных полос белковых компонентов присутствуют также характерные полосы фосфолипидов (табл. 1). Острые полосы при 2923 и 2850 см -1 соответствуют метиленовым антисимметричным и симметричным валентным колебаниям длинных липидных ацильных цепей, соответственно, тогда как полоса при 1734 см -1 принадлежит сложноэфирному карбонилу фосфолипидов, триглицеридов и сложные эфиры холестерина 35,44 . Меньшие полосы при 1459 и 1395 см -1 соответствуют деформационным колебаниям групп СН 2 и СН 3 из липидных цепей.Полосы при 1299 и 1238 см -1 могут быть отнесены к полосам валентных колебаний PO 2 фосфолипидов, однако мода валентных колебаний C-N белков (полоса амида III) появляется также в этой области спектра. Низкочастотная часть большей частью маскируется буферными колебаниями. Действительно, тройные полосы при 1078, 981 и 851 см -1 принадлежат неорганическим фосфатным колебаниям буфера PBS. В некоторых случаях анализ спектра REV может вызвать трудности из-за низких концентраций EV, когда в спектре преобладают признаки PBS.Таким образом, тщательное вычитание буферного фона необходимо для подробного спектрального анализа.

    Рисунок 4

    Репрезентативные необработанные ИК-спектры очищенных образцов REV. Для лучшей наглядности спектры сдвинуты по вертикали. В ранние моменты времени выделения в спектрах преобладает фон буфера PBS.

    Таблица 1 Расположение и назначение типовых ИК-диапазонов РЭМ.

    Определение концентрации общего белка является одним из самых простых способов характеристики электромобилей.Общее содержание белка можно оценить с помощью стандартных колориметрических анализов белка (бицинхониновой кислоты (BCA) или анализа Брэдфорда). Совсем недавно мы представили безметочный метод оценки концентрации общего белка в интактных EV с использованием ATR-IR-спектроскопии 46 . Поскольку интенсивная ИК-полоса белков (полоса амида I примерно при 1654 см -1 ) пропорциональна количеству пептидных групп, с использованием надлежащей калибровочной кривой и тщательного протокола оценки спектра общее содержание белка можно оценить по ИК-спектру. спектры образцов РЭВ (рис.5А). Концентрация общего белка была дополнительно проверена с помощью обычного колориметрического анализа Бредфорда, в результате чего были получены очень похожие результаты, как показано на рис. S1.

    Рисунок 5

    Концентрации общего белка ( A ) и «спектроскопическое отношение белка к липиду» ( B ), рассчитанные на основе ИК-спектров образцов REV, выделенных в разные моменты времени. Столбики погрешностей обозначают стандартные отклонения.

    Удивительно, но концентрация белка не увеличивалась непрерывно со временем хранения.Различные закономерности, полученные для содержания белка и количества частиц, позволяют предположить, что везикулы (частицы) из разных субпопуляций также могут различаться по своему химическому составу (рис. S2).

    Еще одним преимуществом ИК-спектроскопии является одновременное получение полос поглощения белковых и липидных компонентов. Поскольку они хорошо различимы, спектроскопическое соотношение белков и липидов было предложено в качестве параметра для характеристики ЭВ 35,47 . Значения отношения «спектроскопический белок к липиду» для различных образцов REV, рассчитанные как отношение интегрированных площадей полосы амида I и растяжения C–H (от 3040 до 2800 см -1 область волновых чисел) , представлены на рис.5Б. Мы должны подчеркнуть, что до тех пор, пока концентрация белка выражается в абсолютном значении (мг/мл), «спектроскопическое отношение белка к липиду» является порядковым номером для характеристики ЭВ.

    Большинство образцов REV показали спектроскопические значения P/L в диапазоне от 0,6 до 2, что типично для образцов EV, полученных из эритроцитов, исходя из наших предыдущих результатов 35,44 . Выбросы данных (SAGM_3days, SAGM_8days и PBS_3days) позволяют предположить, что при коротком времени хранения образуется относительно небольшое количество наночастиц, богатых белками.Это полностью согласуется с присутствием небольших наночастиц, что видно на изображениях FF-TEM (рис. 6).

    Рисунок 6

    Электронные микрофотографии, полученные методом замораживания в сочетании с ПЭМ образцов REV, выделенных из эритроцитов, хранившихся в SAGM через 3 дня ( A ), 8 дней ( B ) и 21 день ( C) ), а также в PBS на 3 дня ( D ), 8 дней ( E ) и 21 день ( F ). Стрелками отмечены мелкие частицы, а на вставках показаны отдельные изображения одиночных везикул.

    Несмотря на то, что на микрофотографиях (рис. 6 ) наблюдается ограниченное количество, наблюдается типичных РВВ почти правильной сферической формы со средним диаметром 200 нм. Их поверхность беспорядочно покрыта более мелкими частицами диаметром 5–15 нм, предположительно мембранными белками или белковыми агрегатами 40 . Этот своеобразный рисунок поверхности более выражен в случае хранения в растворе PBS. На изображениях, соответствующих образцу РЭВ, выделенному в ранние (3-дневные) моменты времени, можно обнаружить несколько более мелких образований размером от 20 до 80 нм.Bosman et al. также упомянул о наличии везикул меньшего размера (со средним диаметром примерно 80 нм), называемых «нановезикулами». 24 после ультрацентрифугирования (100 000 ×  г ) надосадочной жидкости хранившихся концентратов эритроцитов. Выполняя подробный анализ ЖХ-МС/МС и оценку данных протеомики, авторы выявили различия в составе микровезикул и нановезикул; они пришли к выводу, что две популяции могут быть созданы разными процессами. Основываясь на испытанном высоком отношении белка к липиду и сравнивая с нашими предыдущими результатами спектроскопических значений P/L на малых везикулах (экзосомах) 35 , мы предполагаем, что наблюдаемые маленькие частицы могут быть белковыми комплексами, а не везикулами.При увеличении времени хранения (21 день) перед выделением наночастицы больше не обнаруживались (рис. 6C, F). Кажется правдоподобным, что высвобождение более мелких объектов характерно для раннего повреждения эритроцитов, и с увеличением числа более крупных везикул эти наночастицы сливаются с везикулами или соединяются с ними, на что указывает спектроскопическое соотношение белков и липидов, типичное для ЭВ. . Примечательно, что в PBS эти наночастицы не обнаруживались после 8 дней хранения. Эти результаты довольно хорошо согласуются с результатами MRPS и могут служить объяснением повышенных спектроскопических соотношений белков и липидов.

    Поскольку положение и форма полос ИК-поглощения зависят от внутри- и межмолекулярных взаимодействий, метод ИК-спектроскопии может быть чувствителен к незначительным биомолекулярным изменениям. Детальный спектральный анализ выполнен с использованием вторых производных спектров образцов РЭВ. Мы сосредоточились на трех областях спектра, связанных с валентными колебаниями C–H (от 3050 до 2800 см -1 ), полосами амида I и амида II белковых остовов (от 1700 до 1500 см -1 ) и отпечатков пальцев. область (от 1300 до 1000 см -1 ), содержащая фосфатные и эфирно-эфирные колебания.

    Антисимметричное и симметричное растяжение длинных ацильных цепей липидов (ν as CH 2 и ν s CH 2 около 2920 см −1 −4 см 5, 9036 4 см соответственно) 5, 9036 4 см чувствительные параметры упорядочения и упаковки липидов, формирующие липидный бислой 48,49,50,51 . Как показывают вторые производные на рис. 7A, существуют небольшие, но определенные различия в положениях полос валентных колебаний CH 2 относительно REV с раннего хранения.Это еще раз подтверждает предыдущие результаты, свидетельствующие о том, что в большинстве случаев частицы с немного другим липидным составом и/или организацией образуются в первые 8 дней при использовании добавок SAGM. В буфере PBS не наблюдалось существенной разницы в положении пиков липидов, что соответствовало бы повышенному уровню везикул даже в начальной точке выделения. Стоит отметить, что после 21 дня хранения спектральные характеристики валентных колебаний C–H одинаковы независимо от среды хранения. Рис. 7Усредняли не менее 3 спектров, соответствующих 3 разным биологическим репликам (начиная от разных доноров). Для лучшей наглядности спектры образцов SAGM_21days, PBS_8days и PBS_21 days умножены на 0,05, 0,2 и 0,1 соответственно.

    Спектральная область от 1700 до 1500 см -1 характерна для белковых компонентов, включающих два известных поглощения амидов, называемых амидом I и амидом II. Амид I образуется главным образом в результате растяжения С=О пептидного остова и используется для оценки вторичной структуры белков.Оболочка амида I может быть разделена на отдельные компоненты полосы (с использованием ИК-спектров второй производной, самодеконволюции Фурье, например), которые характерны для α-спирали, β-листа, поворота, случайного и т. д. содержания белков. . На рисунке 8 показаны спектральные различия образцов REV. Образцы раннего хранения демонстрируют разнообразие вторичных структур белка; производные ИК-спектры образцов REV, хранящихся в SAGM, показывают изменчивость спиральных структур, на которую указывает двойной пик при 1660 и 1654 см -1 .Эти изменения также отражаются в области полосы амида II, возникающей из-за деформационных колебаний NH и колебаний C-N пептидных групп (рис. 7A). В дополнение к спиральным конформациям также наблюдаются полосы, принадлежащие β-слоям (на 1625 и 1676 см -1 ) и β-поворотам (на 1687 см -1 ). Минимум производной при 1607 см -1 может быть отнесен к ненативным межмолекулярным β-слоям, что предполагает наличие агрегированных белков 35,52 . REV, выделенные через 21 день хранения (SAGM_21days), характеризуются преобладающим спиральным вкладом (компонент полосы амида I с центром на 1657 см -1 ).Точно так же для REV, образованных в PBS, преобладает спиральная структура белка. Это согласуется с повышенным относительным содержанием гемоглобина (преимущественно белка α-спирали) REV, хранящихся в PBS (рис. S3). Однако в момент ранней изоляции (PBS_3 дня) наличие производных пиков, соответствующих β-листам, β-поворотам и агрегированным белкам, подтверждает присутствие богатых белком частиц, подобных REV из аддитивного раствора SAGM. REV, выделенные после 21 дня хранения, демонстрируют очень похожие спектральные характеристики, что позволяет предположить, что белковый состав высвобожденных REV имеет тенденцию быть сопоставимым.Рисунок 8 Усредняли не менее 3 спектров, соответствующих 3 разным биологическим репликам (начиная от разных доноров). Для лучшей наглядности спектры образцов SAGM_21days, PBS_8days и PBS_21 days умножены на 0,05, 0,2 и 0,1 соответственно.

    Область волновых чисел ниже 1300 см −1 ИК-спектра обычно называется областью отпечатков пальцев и обычно содержит сложную серию различных полос поглощения, уникальных для конкретного образца.Спектральная область отпечатков пальцев образцов REV в диапазоне от 1300 до 1000 см -1 представлена ​​​​в виде вторых производных на рис. 9. Эта область может содержать валентные колебания P-O и C-O фосфолипидов, триглицеридов, эфира холестерина и сахаров. , такие как глюкоза и лактат, потенциально присутствующие в образцах крови. Мы должны отметить, однако, что неорганический фосфат может иметь большой вклад в этой области, поэтому поправка на компоненты буфера PBS имеет решающее значение. Рис. 9Усредняли не менее 3 спектров, соответствующих 3 разным биологическим репликам (начиная от разных доноров). Для лучшей наглядности спектры образцов SAGM_21days, PBS_8days и PBS_21 days умножены на 0,05, 0,1 и 0,2 соответственно.

    Область отпечатков пальцев раннего изолированного образца REV (SAGM_3days) отличается от области SAGM-8 дней и SAGM-21 дней (рис. 9A). В спектрах второй производной преобладают пики при 1192 и 1067 см -1 , относящиеся к антисимметричному PO 2 и растяжению P = O, соответственно, полифосфата в аденозинтрифосфате 53,54 .Спектральные особенности АТФ также можно наблюдать для ранних образцов REV, выделенных из буфера PBS (рис. 9B). Образцы REV, выделенные из эритроцитов, хранящихся в PBS, с большим количеством везикул, имеют более интенсивные фосфатные полосы около 1235 и 1080 см -1 , что соответствует антисимметричным и симметричным валентным колебаниям PO 2 , соответственно, сложных эфиров фосфатов липидов. Более широкие полосы около 1020–1030 см -1 могут соответствовать группам фосфатного диэфира в головной группе фосфолипида.Полоса на 1170 см -1 , также более выраженная в REV, полученных из хранилища PBS, может быть отнесена к растяжению C–O–C фосфолипидов, сложных эфиров холестерина и/или триглицеридов. Более высокая интенсивность полос, связанных с фосфолипидами, в этой области волновых чисел соответствует более выраженным валентным колебаниям этилена соответствующих фрагментов ацильной цепи (рис. 7).

    Четко определенные полосы на 1152 см -1 и 1125 см -1 можно идентифицировать в спектре второй производной образцов РЭВ, выделенных после 3-дневного хранения.Согласно Писториусу и др. 54 мы отнесли полосу на 1152 см -1 к растяжению С-О-С глюкозы; они выбрали ту же полосу для характеристики уровня глюкозы в концентратах эритроцитов с помощью ИК-спектроскопии. Действительно, последние результаты протеомики образцов REV, выполненные Босманом и его коллегами 22 , подтверждают наличие белков, связанных с энергетическим метаболизмом эритроцитов. Интересно отметить, что для остальных РЯВ полоса, связанная с глюкозой, подавлена, а полоса на 1125 см -1 , соответствующая лактату, увеличивается 54 .Относительная интенсивность полосы лактата была самой высокой для 8-дневных образцов, хранившихся в SAGM. Поскольку метаболом REV отражает кинетику энергетического метаболизма эритроцитов, кажется вероятным, что существует связь между путем длительного гликолиза и замедленной везикуляцией. Кроме того, при коротком времени хранения образцы REV могут также содержать аденозинтрифосфат (АТФ), о чем свидетельствует наличие полос при 1192 и 1067 см -1 , принадлежащих PO 2 и P = O полифосфатов 54 .

    Другим маркерным ИК-диапазоном является полоса на 1106 см -1 . Эта полоса относится к окисленному гемоглобину 55 и соответствует несимметричной связи между железом гема и кислородом 56 . Повышенная интенсивность полосы оксигемоглобина в спектрах REV, хранящихся в PBS, соответствует результатам УФ-видимой спектроскопии, указывающим на повышенную относительную концентрацию гемоглобина (рис. S3).

    Максимально допустимый срок хранения продуктов РБК обычно составляет 42 дня 57 .Однако для снижения общих рисков, связанных с переливанием крови, на основе особых требований к переливанию используется классификация эритроцитов как « молодых» (< 14–21 дней) по сравнению с «старых» (> 21 дней) 58 . REV, выделенные из эритроцитов, хранящихся в SAGM в течение 21 дня, имитируют условия хранения крови. Стоит отметить, что спектральные изменения из-за разных носителей информации не столь значительны, как для ранних изолированных РВВ. Лишь небольшие, но заметные изменения наблюдаются в спектральной области отпечатков пальцев РЗВ (рис.8). Полосы в области волновых чисел 1245–1220 см -1 и 1032 см -1 соответствуют антисимметричным валентным колебаниям фосфолипидов PO 2 и сложных эфиров липидов (R–O–P–O–R’). , соответственно, и спектральные вариации предполагают некоторые различия в составе головной группы липидов и/или геометрии для двух образцов REV. В производном спектре поздних REV, хранящихся в PBS, можно наблюдать дополнительные полосы на 1204, 1022 и 1008 см -1 . Эти полосы могут принадлежать углеводам/гликогенам 54 .Представляется правдоподобным, что во время хранения везикулы обогащаются не только гемоглобином, но и специфическими для мембран эритроцитов гликопротеинами, такими как полоса 3 или гликофорин A-D. Недавние протеомные исследования REV, выделенных в разное время хранения из банков крови, показывают, что обогащение белком полосы 3 в везикулах достигло максимума через 3 недели хранения 22 . Что касается нашего эксперимента, мы предполагаем, что в REV, хранящихся в PBS, гемоглобин и полоса 3 также могут присутствовать в более высоком процентном соотношении, чем в REV, связанных с SAGM.Дополнительные полосы в производных спектрах могут быть отнесены к C–O–C сложных эфиров холестерина/фосфолипидов/триглицеридов (около 1170 см -1 ), лактату (1125 см -1 ) и оксигемоглобину (1106 см — 1 ). Содержание гемоглобина в образцах REV также зависит от условий хранения. В целом, REV из эритроцитов, хранившихся в изотоническом буферном растворе PBS, содержали более высокие уровни гемоглобина, и его относительное количество увеличивалось со временем хранения, что также отражалось в росте полосы оксигемоглобина при 1106 см -1 .

    Скрининг эритроцитов на содержание внеклеточных везикул как показатель качества продукции

    Фон: Споры вокруг качества и клинического воздействия хранящихся и дифференцированно изготовленных концентратов эритроцитов (ККК) от разных групп доноров продолжаются. Текущие исследования ограничены отсутствием мер качества, подходящих для рутинного скрининга почечно-клеточного рака.Поскольку внеклеточные везикулы (ВВ) являются маркерами клеточной активации или деградации, в этом исследовании изучалась полезность скрининга ВВ для характеристики эффектов методов производства и хранения эритроцитов.

    Дизайн и методы исследования: ПКР готовили методами фильтрации цельной крови или эритроцитов (эритроцитов), центрифугировали для приготовления супернатанта и тестировали на содержание ЭВ (методы динамического светорассеяния или настраиваемого резистивного измерения пульса), гемолиза, АТФ и деформируемости эритроцитов в дни. 7, 21 и 42 хранилища.Для имитации неразрушающего контроля качества (КК) 1 единицу эритроцитов тестировали параллельно с шестью аликвотами по 10 мл, которые хранились в контейнерах небольшого объема.

    Полученные результаты: Содержание EV линейно увеличивалось со временем хранения (p <0,001) и коррелировало с гемоглобином надосадочной жидкости и обратно пропорционально деформируемости АТФ или эритроцитов. Способ изготовления компонентов повлиял на характеристики электромобилей при хранении.Наблюдалась сильная корреляция между показателями общего EV обоих методов тестирования EV. Содержание EV в шести аликвотах было одинаковым в каждый момент времени, но статистически выше, чем в исходных RCC на и после 21 дня хранения.

    Выводы: Содержание ЭВ коррелирует с показателями гемолиза и другими показателями качества эритроцитов и может быть реализовано в качестве рутинного инструмента скрининга для неразрушающего контроля качества ПКР.

    Везикулы: обзор и многое другое

    Везикула, также известная как волдырь или везикулярное поражение, образуется, когда жидкость попадает под верхний слой кожи (эпидермис), образуя пузыревидный мешок.

    Везикулы могут возникать в результате ветряной оспы, экземы, сыпи из-за раздражения кожи или аллергии, опоясывающего лишая, трения, бактериальных инфекций и простого герпеса.

    В этой статье объясняются симптомы, причины, диагностика и лечение везикул.

    Джоан Грин / Getty Images

    Симптомы везикул

    Везикулы выглядят как маленькие пузырьки на коже. Обычно они выглядят как маленькие пузырьки жидкости и имеют диаметр менее одного сантиметра. (Если волдырь больше одного сантиметра, его называют буллой, а не пузырьком.)

    Везикулы очень легко вскрываются. Чем он больше, тем больше вероятность того, что он лопнет, что может быть болезненно. При этом выделяется жидкость, которая при высыхании образует на коже желтую корку.

    Везикулы также могут вызывать воспаление в окружающей области. Существует больший риск инфекции, если везикула лопается преждевременно до заживления подлежащей кожи.

    Что вызывает везикулы?

    Многие вещи могут вызвать везикулы. Некоторые, например трение, считаются незначительными. Если вы когда-нибудь разнашивали новую пару обуви, играли несколько раундов в теннис или несколько часов занимались физическим трудом, вы, вероятно, сталкивались с подобными волдырями от трения.

    Другие причины включают в себя:

    • Аллергические реакции
    • Бернс
    • Воздействие химических веществ
    • Контактный дерматит, сыпь, возникающая при раздражении кожи чем-либо
    • Ядовитый плющ или ядовитый дуб
    • Экзема, кожное заболевание, вызывающее сыпь, при которой могут образовываться сочащиеся волдыри
    • Бактериальные кожные инфекции, такие как рожистое воспаление (St.Антония Огонь) или импетиго
    • Грибковые инфекции, такие как дерматофития стоп (стригущий лишай)
    • Болезнь рук и ног (HFMD), вирусная инфекция
    • Varicella zoster (ветряная оспа), вирусное заболевание, вызывающее появление волдырей на коже
    • Herpes zoster (опоясывающий лишай), реактивация спящего вируса ветряной оспы
    • Вирус простого герпеса типа 1 (ВПГ-1) и типа 2 (ВПГ-2), вирусные инфекции, вызывающие волдыри вокруг рта и половых органов
    • Сифилис, инфекция, передающаяся половым путем
    • Буллезный пемфигоид, редкое аутоиммунное заболевание, при котором иммунная система атакует здоровые клетки в первых двух слоях кожи, вызывая хронические волдыри)
    • Пузырчатка, редкий тип аутоиммунного заболевания, при котором иммунная система ошибочно атакует здоровые клетки кожи и слизистых оболочек, таких как слизистая рта

    Диагностика

    Везикулы легко распознать, так как они появляются на поверхности кожи.Но поскольку существует так много потенциальных причин, поставщик медицинских услуг может легко поставить неверный диагноз, если не проведет тщательной оценки.

    Диагностика везикул может включать:

    • История болезни
    • Физикальное обследование с дерматоскопией (осмотр волдырей с помощью увеличительного портативного устройства)
    • Анализы крови
    • STD тестирование
    • Грибковые или бактериальные культуры из струпьев или везикулярной жидкости
    • Биопсия кожи (берется образец волдыря и исследуется под микроскопом)

    Лечение

    Лечение везикул зависит от причины.Во многих случаях медицинские работники лечат везикулы лекарствами, отпускаемыми без рецепта. Иногда они заживают сами по себе.

    Лечение везикул может включать:

    Как бы заманчиво это ни было, не ковыряйте и не царапайте повреждения. Лучше держать область в чистоте, а все неповрежденные пузырьки запечатывать, чтобы кожа под ними могла зажить.

    Если везикула опухла и болезненна, медицинский работник может дренировать жидкость стерильными инструментами. Это помогает коже эффективно заживать, не рискуя инфекцией.

    Когда обратиться к поставщику медицинских услуг

    Если вы не уверены, почему у вас везикулы, лучше обратиться к врачу. Правильный диагноз может гарантировать, что вы используете правильное лечение для скорейшего устранения волдырей.

    Получение оценки также может гарантировать, что вы правильно справляетесь с любым состоянием или болезнью, которые могли вызвать эти поражения.

    Кроме того, обязательно оцените везикулы, если они:

    • Большой
    • Постоянный/множащийся
    • На большей части тела
    • Изменение цвета или формы

    Если вы заметили какие-либо признаки инфекции, немедленно обратитесь за медицинской помощью.Это включает:

    • Лихорадка
    • Головная боль
    • Озноб
    • Усталость
    • Мышечные боли
    • Увеличение лимфатических узлов

    Профилактика

    Везикулы не всегда можно предотвратить. Например, те, которые вызваны ядовитым плющом или вирусом, могут появиться снова после другого воздействия.

    Тем не менее, вы можете принять некоторые профилактические меры, чтобы ограничить риск образования везикул, в том числе:

    • Избегайте известных аллергенов.
    • Не делитесь с другими соломинками, чашками и средствами по уходу за губами.
    • Соблюдайте правила гигиены, особенно мытье рук.
    • Лечите хронические заболевания, чтобы ограничить обострения.
    • Используйте презервативы и другие барьеры во время полового акта.
    • Раннее выявление ИППП с помощью рутинного скрининга.
    • Будьте в курсе вакцин, таких как ветряная оспа и опоясывающий лишай.

    Резюме

    Везикулы представляют собой пузыри с жидкостью, которые появляются на верхнем слое кожи.Эти волдыри могут лопнуть и оставить после себя твердую желтую пленку.

    Многие вещи могут вызывать волдыри, в том числе некоторые бактериальные, грибковые и вирусные инфекции, аутоиммунные заболевания, хронические кожные заболевания и аллергии.

    Лечение везикул зависит от причины, но может включать антибиотики, противогрибковые, противовирусные препараты, местные стероиды, НПВП, антигистаминные препараты и биологические препараты.

    Слово из Веривелла

    Если у вас есть пузырьки, вам может быть трудно удержаться от их расчесывания.Но имейте в виду, что это может привести к образованию рубцов. Поэтому постарайтесь избежать этого, если сможете. Ношение мягких варежек или носков на руках (или руках ваших детей) иногда может помочь, особенно во время сна.

    Часто задаваемые вопросы

    • Где образуются везикулы?

      Везикулы, также называемые волдырями, могут образовываться в любом месте на коже. Тем не менее, руки и ноги являются наиболее частыми местами образования волдырей.

    • Везикулы чешутся?

      Да, везикула может чесаться.Однако старайтесь не царапать, так как это может привести к разрыву.